Incidental Mutation 'R6321:Capsl'
ID 510366
Institutional Source Beutler Lab
Gene Symbol Capsl
Ensembl Gene ENSMUSG00000039676
Gene Name calcyphosine-like
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.104) question?
Stock # R6321 (G1)
Quality Score 225.009
Status Validated
Chromosome 15
Chromosomal Location 9436028-9466038 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 9461769 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Leucine at position 84 (F84L)
Ref Sequence ENSEMBL: ENSMUSP00000035663 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042360] [ENSMUST00000226688]
AlphaFold Q6P8Y1
Predicted Effect probably damaging
Transcript: ENSMUST00000042360
AA Change: F84L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000035663
Gene: ENSMUSG00000039676
AA Change: F84L

DomainStartEndE-ValueType
EFh 43 71 7.28e-1 SMART
EFh 79 107 2.09e-4 SMART
EFh 115 143 3.3e-2 SMART
EFh 158 188 2.31e1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000226688
AA Change: F84L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Meta Mutation Damage Score 0.6699 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.8%
Validation Efficiency 100% (52/52)
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5430419D17Rik T C 7: 131,257,006 probably null Het
Actbl2 G T 13: 111,255,381 M83I probably damaging Het
Adgra2 T A 8: 27,114,162 M460K probably benign Het
Aldh16a1 G A 7: 45,149,765 A31V probably damaging Het
Ank2 T C 3: 126,946,938 probably benign Het
Arrdc4 C A 7: 68,749,045 D8Y probably benign Het
Auts2 A G 5: 131,466,115 Y110H probably damaging Het
Blnk A T 19: 40,934,459 Y405N probably damaging Het
Cenpl T C 1: 161,074,895 S46P probably benign Het
Chd1l G A 3: 97,587,167 A399V probably damaging Het
Chrnd C T 1: 87,192,229 R90C probably damaging Het
Cyfip2 A T 11: 46,291,520 M37K probably benign Het
Dnah11 T C 12: 118,142,292 E625G possibly damaging Het
Dnah5 T G 15: 28,372,411 V2936G probably damaging Het
Dock9 A G 14: 121,546,021 M2055T probably damaging Het
Epb41l2 A T 10: 25,468,128 R274S probably damaging Het
Erich3 A T 3: 154,727,502 H371L probably damaging Het
Evi5l C A 8: 4,203,080 P454T probably benign Het
Gm10549 C A 18: 33,464,305 probably benign Het
Gm11595 G A 11: 99,772,555 R100C unknown Het
Golgb1 T A 16: 36,918,197 C2299* probably null Het
Heca G C 10: 17,915,243 probably null Het
Hecw1 C T 13: 14,522,829 A9T probably benign Het
Hs3st6 T A 17: 24,758,568 W341R probably damaging Het
Kidins220 C T 12: 25,057,534 S1571L probably benign Het
Klk9 A G 7: 43,794,308 E82G probably damaging Het
Ltbp3 C A 19: 5,745,657 H180Q probably benign Het
Mecom A G 3: 29,980,592 Y502H probably damaging Het
Mfsd2a A G 4: 122,949,372 V372A probably benign Het
Mrgprd A G 7: 145,322,142 D250G probably benign Het
Muc2 A G 7: 141,700,828 D191G probably benign Het
Myl10 G C 5: 136,697,971 V70L probably benign Het
Naip6 C A 13: 100,300,401 S538I probably benign Het
Olfr1312 A G 2: 112,042,768 V88A probably benign Het
Olfr692 A G 7: 105,368,902 Y192C probably damaging Het
Pnpla6 T C 8: 3,544,015 V1342A probably benign Het
Ppp1r9a A G 6: 5,115,151 E789G probably damaging Het
Prkdc A G 16: 15,714,919 T1471A probably benign Het
Scarb1 T A 5: 125,304,331 S50C probably damaging Het
Slc4a8 C T 15: 100,789,164 T283M probably damaging Het
Smc2 C A 4: 52,462,814 D601E probably benign Het
Snx6 C A 12: 54,752,013 V221F probably damaging Het
Spag17 A C 3: 100,088,427 K1794T probably benign Het
Tpo A G 12: 30,103,108 W416R probably damaging Het
Ttc13 C A 8: 124,683,191 K427N probably damaging Het
Upf3a A T 8: 13,787,466 N137I possibly damaging Het
Ush2a C T 1: 188,849,046 Q3708* probably null Het
Zbtb17 G A 4: 141,463,383 G171S probably benign Het
Zfp451 A G 1: 33,813,735 F33L probably damaging Het
Zfp454 A G 11: 50,873,049 F408L probably damaging Het
Zfp639 T C 3: 32,517,088 Y40H probably damaging Het
Other mutations in Capsl
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0492:Capsl UTSW 15 9461844 splice site probably benign
R1187:Capsl UTSW 15 9457721 missense probably damaging 1.00
R1868:Capsl UTSW 15 9461830 nonsense probably null
R2311:Capsl UTSW 15 9462603 nonsense probably null
R2434:Capsl UTSW 15 9462709 missense probably damaging 1.00
R4798:Capsl UTSW 15 9461742 missense probably benign
R4887:Capsl UTSW 15 9457772 missense possibly damaging 0.87
R5306:Capsl UTSW 15 9457790 missense probably benign 0.00
R6002:Capsl UTSW 15 9461788 missense probably damaging 0.97
R6156:Capsl UTSW 15 9465834 missense probably damaging 1.00
R7316:Capsl UTSW 15 9461802 missense probably benign 0.15
R7767:Capsl UTSW 15 9462684 missense probably damaging 0.99
R9108:Capsl UTSW 15 9465824 missense possibly damaging 0.87
X0063:Capsl UTSW 15 9462706 missense possibly damaging 0.56
Predicted Primers PCR Primer
(F):5'- GACAAAGAGGAGTGTTTCGC -3'
(R):5'- GGTCTGGTTCATTCTGCTACGC -3'

Sequencing Primer
(F):5'- AAGAGGAGTGTTTCGCTCTTTTTATC -3'
(R):5'- TCATTCTGCTACGCTGATTGG -3'
Posted On 2018-04-02