Incidental Mutation 'R6326:Cdk5rap2'
ID 510393
Institutional Source Beutler Lab
Gene Symbol Cdk5rap2
Ensembl Gene ENSMUSG00000039298
Gene Name CDK5 regulatory subunit associated protein 2
Synonyms an, 2900018K03Rik
MMRRC Submission 044480-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.449) question?
Stock # R6326 (G1)
Quality Score 225.009
Status Not validated
Chromosome 4
Chromosomal Location 70135092-70328672 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 70153691 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Cysteine at position 1711 (S1711C)
Ref Sequence ENSEMBL: ENSMUSP00000119891 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076541] [ENSMUST00000138561] [ENSMUST00000144099]
AlphaFold Q8K389
Predicted Effect probably benign
Transcript: ENSMUST00000076541
Predicted Effect probably benign
Transcript: ENSMUST00000138561
SMART Domains Protein: ENSMUSP00000116928
Gene: ENSMUSG00000039298

DomainStartEndE-ValueType
Blast:BRLZ 228 284 1e-13 BLAST
low complexity region 297 314 N/A INTRINSIC
low complexity region 368 386 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000144099
AA Change: S1711C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000119891
Gene: ENSMUSG00000039298
AA Change: S1711C

DomainStartEndE-ValueType
Pfam:Cnn_1N 58 130 3.6e-26 PFAM
coiled coil region 210 345 N/A INTRINSIC
low complexity region 368 381 N/A INTRINSIC
coiled coil region 388 462 N/A INTRINSIC
coiled coil region 569 616 N/A INTRINSIC
low complexity region 761 776 N/A INTRINSIC
low complexity region 791 800 N/A INTRINSIC
coiled coil region 960 1001 N/A INTRINSIC
coiled coil region 1112 1140 N/A INTRINSIC
coiled coil region 1200 1237 N/A INTRINSIC
Blast:BRLZ 1479 1535 6e-13 BLAST
low complexity region 1548 1565 N/A INTRINSIC
low complexity region 1619 1637 N/A INTRINSIC
low complexity region 1700 1711 N/A INTRINSIC
low complexity region 1811 1822 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a regulator of CDK5 (cyclin-dependent kinase 5) activity. The protein encoded by this gene is localized to the centrosome and Golgi complex, interacts with CDK5R1 and pericentrin (PCNT), plays a role in centriole engagement and microtubule nucleation, and has been linked to primary microcephaly and Alzheimer's disease. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2013]
PHENOTYPE: Homozygous mutant phenotype varies by strain background. Severely affected mutants exhibit small size, severe anemia, and neonatal death. Mildly affected mutants are viable with mild macrocytic anemia, reduced fertility and radiation senstitivity. [provided by MGI curators]
Allele List at MGI

All alleles(22) : Targeted, other(1) Gene trapped(20) Radiation induced(1)

Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts17 A T 7: 66,770,636 (GRCm39) Y915F probably benign Het
Adap2 T A 11: 80,045,848 (GRCm39) F43I probably damaging Het
Adprs A T 4: 126,210,406 (GRCm39) L358Q possibly damaging Het
Akap9 A C 5: 4,012,061 (GRCm39) Q921H probably damaging Het
Amigo2 A G 15: 97,143,256 (GRCm39) S389P probably benign Het
Atg2b A T 12: 105,627,351 (GRCm39) C545* probably null Het
C2cd3 A G 7: 100,065,635 (GRCm39) E807G probably benign Het
Ccdc110 A G 8: 46,395,078 (GRCm39) E323G probably damaging Het
Cebpzos T G 17: 79,226,486 (GRCm39) D39E probably damaging Het
Cenpe A G 3: 134,945,539 (GRCm39) N1018D probably benign Het
Cfap68 T G 9: 50,676,057 (GRCm39) N87T probably damaging Het
Clspn C A 4: 126,459,532 (GRCm39) H141Q probably damaging Het
Cluh C T 11: 74,557,068 (GRCm39) A1010V probably benign Het
Col27a1 G T 4: 63,242,678 (GRCm39) probably benign Het
Cpt2 T C 4: 107,771,513 (GRCm39) M61V probably benign Het
Ddr2 T A 1: 169,814,709 (GRCm39) H578L probably damaging Het
Dnah14 T A 1: 181,611,121 (GRCm39) I3749N probably damaging Het
Dnajc18 T C 18: 35,813,978 (GRCm39) T264A possibly damaging Het
Ecpas T A 4: 58,827,068 (GRCm39) T1022S probably benign Het
Eml6 T C 11: 29,769,066 (GRCm39) N693S probably damaging Het
Ephx4 A G 5: 107,553,977 (GRCm39) E9G probably damaging Het
Eps15l1 G A 8: 73,095,278 (GRCm39) Q747* probably null Het
Flrt1 C T 19: 7,073,974 (GRCm39) S191N probably damaging Het
Gm5114 C T 7: 39,057,579 (GRCm39) R680H probably benign Het
Gm5431 T C 11: 48,780,172 (GRCm39) H250R probably damaging Het
Gm7233 T C 14: 43,040,342 (GRCm39) C198R possibly damaging Het
Herc2 C G 7: 55,872,682 (GRCm39) Q4407E probably damaging Het
Hmx3 C G 7: 131,144,734 (GRCm39) probably benign Het
Hoxb7 C A 11: 96,177,909 (GRCm39) A119E probably benign Het
Ifi207 A T 1: 173,557,532 (GRCm39) M402K probably benign Het
Ints14 T C 9: 64,871,719 (GRCm39) V19A probably benign Het
Itgae T A 11: 73,022,519 (GRCm39) N911K possibly damaging Het
Kif1a T C 1: 93,004,048 (GRCm39) S145G probably damaging Het
Klhdc4 A G 8: 122,531,793 (GRCm39) W187R probably damaging Het
Krt1 A T 15: 101,758,684 (GRCm39) I160N probably damaging Het
Krt12 T C 11: 99,307,745 (GRCm39) T448A probably benign Het
Lcmt2 G A 2: 120,969,938 (GRCm39) R382* probably null Het
Map3k8 C T 18: 4,340,651 (GRCm39) S221N probably damaging Het
Med17 T C 9: 15,190,854 (GRCm39) D79G probably benign Het
Mlf1 A T 3: 67,307,060 (GRCm39) I257F probably damaging Het
Mov10l1 T A 15: 88,879,098 (GRCm39) F153I probably damaging Het
Msto1 A C 3: 88,819,405 (GRCm39) V149G probably damaging Het
Mybl1 T C 1: 9,748,732 (GRCm39) probably null Het
Myoc A G 1: 162,476,580 (GRCm39) Y428C probably damaging Het
Nin A G 12: 70,091,955 (GRCm39) S785P possibly damaging Het
Oit3 A T 10: 59,264,061 (GRCm39) F358I probably damaging Het
Or5t15 C T 2: 86,681,338 (GRCm39) V235I probably benign Het
Or6c88 A G 10: 129,406,571 (GRCm39) T16A possibly damaging Het
Paip1 A G 13: 119,566,753 (GRCm39) N29S probably benign Het
Pcdhgb4 T C 18: 37,855,509 (GRCm39) S635P probably benign Het
Pcsk1 A G 13: 75,280,298 (GRCm39) N708D possibly damaging Het
Plch1 C T 3: 63,688,811 (GRCm39) W131* probably null Het
Prag1 A T 8: 36,569,860 (GRCm39) M148L possibly damaging Het
Ptch1 A G 13: 63,691,359 (GRCm39) L176P probably damaging Het
Ralgapa1 A T 12: 55,793,931 (GRCm39) V568D probably damaging Het
Rb1 A T 14: 73,435,974 (GRCm39) M897K probably benign Het
Resf1 T A 6: 149,230,493 (GRCm39) Y1180N probably damaging Het
Robo3 T A 9: 37,338,323 (GRCm39) Q386L probably damaging Het
Rtn4rl1 T C 11: 75,156,828 (GRCm39) V420A possibly damaging Het
Sall1 A T 8: 89,756,896 (GRCm39) N1069K probably benign Het
Sipa1l1 A G 12: 82,419,242 (GRCm39) E640G probably damaging Het
Slc22a2 C A 17: 12,831,297 (GRCm39) Y362* probably null Het
Slc5a9 T C 4: 111,737,450 (GRCm39) E603G probably benign Het
Slc6a17 A T 3: 107,407,722 (GRCm39) I83N probably damaging Het
Snx29 G T 16: 11,221,430 (GRCm39) M285I probably benign Het
Spata2 T C 2: 167,326,094 (GRCm39) T242A possibly damaging Het
Stard13 A G 5: 150,970,384 (GRCm39) L733P possibly damaging Het
Svep1 A G 4: 58,073,045 (GRCm39) V2088A possibly damaging Het
Tdp2 A G 13: 25,024,540 (GRCm39) E279G probably damaging Het
Tnfrsf8 T G 4: 144,995,794 (GRCm39) I422L probably damaging Het
Tpk1 T A 6: 43,323,736 (GRCm39) T189S possibly damaging Het
Trhde A T 10: 114,403,129 (GRCm39) M498K probably damaging Het
Trim35 T A 14: 66,540,653 (GRCm39) H168Q possibly damaging Het
Tubb5 T C 17: 36,147,347 (GRCm39) probably benign Het
Tut4 C T 4: 108,336,177 (GRCm39) T6I probably benign Het
Vmn1r181 G A 7: 23,684,183 (GRCm39) R216Q probably benign Het
Vmn2r77 G A 7: 86,451,031 (GRCm39) G306R probably benign Het
Xkr4 C T 1: 3,741,261 (GRCm39) R104H possibly damaging Het
Zfp398 T C 6: 47,843,355 (GRCm39) I337T possibly damaging Het
Other mutations in Cdk5rap2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00425:Cdk5rap2 APN 4 70,321,709 (GRCm39) critical splice donor site probably null
IGL01305:Cdk5rap2 APN 4 70,298,472 (GRCm39) missense possibly damaging 0.52
IGL01987:Cdk5rap2 APN 4 70,220,319 (GRCm39) critical splice donor site probably null
IGL02213:Cdk5rap2 APN 4 70,235,839 (GRCm39) splice site probably benign
IGL02732:Cdk5rap2 APN 4 70,184,902 (GRCm39) nonsense probably null
IGL03063:Cdk5rap2 APN 4 70,273,114 (GRCm39) critical splice acceptor site probably null
IGL03244:Cdk5rap2 APN 4 70,199,672 (GRCm39) missense probably benign 0.19
ANU22:Cdk5rap2 UTSW 4 70,298,472 (GRCm39) missense possibly damaging 0.52
F5426:Cdk5rap2 UTSW 4 70,173,040 (GRCm39) missense probably benign
R0010:Cdk5rap2 UTSW 4 70,161,696 (GRCm39) missense probably benign 0.01
R0010:Cdk5rap2 UTSW 4 70,161,696 (GRCm39) missense probably benign 0.01
R0044:Cdk5rap2 UTSW 4 70,279,138 (GRCm39) missense probably damaging 1.00
R0044:Cdk5rap2 UTSW 4 70,279,138 (GRCm39) missense probably damaging 1.00
R0482:Cdk5rap2 UTSW 4 70,328,506 (GRCm39) start gained probably benign
R0548:Cdk5rap2 UTSW 4 70,267,379 (GRCm39) critical splice donor site probably null
R0594:Cdk5rap2 UTSW 4 70,273,050 (GRCm39) missense probably damaging 0.98
R0737:Cdk5rap2 UTSW 4 70,255,612 (GRCm39) missense probably benign 0.01
R0788:Cdk5rap2 UTSW 4 70,225,468 (GRCm39) missense possibly damaging 0.90
R0960:Cdk5rap2 UTSW 4 70,161,745 (GRCm39) missense probably benign 0.03
R1682:Cdk5rap2 UTSW 4 70,220,387 (GRCm39) missense possibly damaging 0.92
R1727:Cdk5rap2 UTSW 4 70,208,209 (GRCm39) missense possibly damaging 0.70
R1727:Cdk5rap2 UTSW 4 70,190,916 (GRCm39) missense probably benign
R1768:Cdk5rap2 UTSW 4 70,225,470 (GRCm39) missense probably benign 0.09
R1903:Cdk5rap2 UTSW 4 70,321,791 (GRCm39) splice site probably null
R2270:Cdk5rap2 UTSW 4 70,184,915 (GRCm39) missense probably benign 0.01
R2271:Cdk5rap2 UTSW 4 70,184,915 (GRCm39) missense probably benign 0.01
R2272:Cdk5rap2 UTSW 4 70,184,915 (GRCm39) missense probably benign 0.01
R2364:Cdk5rap2 UTSW 4 70,279,046 (GRCm39) critical splice donor site probably null
R2763:Cdk5rap2 UTSW 4 70,199,508 (GRCm39) missense probably benign
R2893:Cdk5rap2 UTSW 4 70,208,110 (GRCm39) missense probably benign
R2894:Cdk5rap2 UTSW 4 70,208,110 (GRCm39) missense probably benign
R2958:Cdk5rap2 UTSW 4 70,208,214 (GRCm39) frame shift probably null
R2959:Cdk5rap2 UTSW 4 70,208,214 (GRCm39) frame shift probably null
R2961:Cdk5rap2 UTSW 4 70,208,214 (GRCm39) frame shift probably null
R2962:Cdk5rap2 UTSW 4 70,208,214 (GRCm39) frame shift probably null
R2963:Cdk5rap2 UTSW 4 70,208,214 (GRCm39) frame shift probably null
R3522:Cdk5rap2 UTSW 4 70,168,647 (GRCm39) missense probably damaging 1.00
R3725:Cdk5rap2 UTSW 4 70,153,674 (GRCm39) missense possibly damaging 0.89
R3726:Cdk5rap2 UTSW 4 70,153,674 (GRCm39) missense possibly damaging 0.89
R3876:Cdk5rap2 UTSW 4 70,208,214 (GRCm39) frame shift probably null
R3919:Cdk5rap2 UTSW 4 70,298,460 (GRCm39) missense possibly damaging 0.50
R4025:Cdk5rap2 UTSW 4 70,168,624 (GRCm39) missense probably damaging 0.98
R4324:Cdk5rap2 UTSW 4 70,271,851 (GRCm39) missense probably damaging 1.00
R4485:Cdk5rap2 UTSW 4 70,157,520 (GRCm39) critical splice donor site probably null
R4516:Cdk5rap2 UTSW 4 70,194,952 (GRCm39) splice site probably null
R4556:Cdk5rap2 UTSW 4 70,157,549 (GRCm39) missense probably damaging 0.97
R4560:Cdk5rap2 UTSW 4 70,233,568 (GRCm39) missense probably benign 0.03
R4584:Cdk5rap2 UTSW 4 70,184,997 (GRCm39) missense probably damaging 1.00
R4620:Cdk5rap2 UTSW 4 70,184,943 (GRCm39) missense probably benign 0.00
R4639:Cdk5rap2 UTSW 4 70,220,413 (GRCm39) missense probably damaging 0.97
R4755:Cdk5rap2 UTSW 4 70,156,662 (GRCm39) missense probably damaging 1.00
R4947:Cdk5rap2 UTSW 4 70,146,829 (GRCm39) splice site probably null
R5116:Cdk5rap2 UTSW 4 70,225,475 (GRCm39) missense possibly damaging 0.67
R5449:Cdk5rap2 UTSW 4 70,194,888 (GRCm39) missense probably benign 0.00
R5643:Cdk5rap2 UTSW 4 70,184,970 (GRCm39) missense probably damaging 0.99
R5899:Cdk5rap2 UTSW 4 70,161,830 (GRCm39) splice site probably benign
R6177:Cdk5rap2 UTSW 4 70,199,719 (GRCm39) missense probably damaging 0.99
R6254:Cdk5rap2 UTSW 4 70,282,269 (GRCm39) missense probably damaging 1.00
R6335:Cdk5rap2 UTSW 4 70,184,849 (GRCm39) missense possibly damaging 0.79
R6534:Cdk5rap2 UTSW 4 70,273,050 (GRCm39) missense probably damaging 0.98
R6857:Cdk5rap2 UTSW 4 70,163,633 (GRCm39) nonsense probably null
R6959:Cdk5rap2 UTSW 4 70,278,906 (GRCm39) splice site probably null
R7104:Cdk5rap2 UTSW 4 70,267,393 (GRCm39) missense probably benign 0.00
R7145:Cdk5rap2 UTSW 4 70,156,468 (GRCm39) missense probably benign 0.13
R7223:Cdk5rap2 UTSW 4 70,153,684 (GRCm39) missense probably benign 0.02
R7234:Cdk5rap2 UTSW 4 70,295,024 (GRCm39) splice site probably null
R7240:Cdk5rap2 UTSW 4 70,210,145 (GRCm39) missense probably damaging 1.00
R7247:Cdk5rap2 UTSW 4 70,255,666 (GRCm39) missense probably damaging 1.00
R7382:Cdk5rap2 UTSW 4 70,208,262 (GRCm39) missense probably benign 0.19
R7413:Cdk5rap2 UTSW 4 70,172,972 (GRCm39) missense probably damaging 1.00
R7576:Cdk5rap2 UTSW 4 70,185,109 (GRCm39) missense probably benign 0.01
R8236:Cdk5rap2 UTSW 4 70,160,722 (GRCm39) missense probably benign
R8434:Cdk5rap2 UTSW 4 70,282,257 (GRCm39) missense probably benign 0.00
R8688:Cdk5rap2 UTSW 4 70,298,510 (GRCm39) missense probably damaging 1.00
R8706:Cdk5rap2 UTSW 4 70,157,562 (GRCm39) missense probably benign 0.08
R8731:Cdk5rap2 UTSW 4 70,163,747 (GRCm39) splice site probably benign
R8782:Cdk5rap2 UTSW 4 70,161,712 (GRCm39) missense possibly damaging 0.57
R8855:Cdk5rap2 UTSW 4 70,218,887 (GRCm39) missense probably damaging 1.00
R8965:Cdk5rap2 UTSW 4 70,185,042 (GRCm39) missense probably benign 0.30
R9242:Cdk5rap2 UTSW 4 70,255,583 (GRCm39) missense possibly damaging 0.46
R9308:Cdk5rap2 UTSW 4 70,328,504 (GRCm39) start codon destroyed probably null 0.99
R9396:Cdk5rap2 UTSW 4 70,182,895 (GRCm39) missense probably damaging 0.97
R9396:Cdk5rap2 UTSW 4 70,172,903 (GRCm39) missense possibly damaging 0.75
R9507:Cdk5rap2 UTSW 4 70,210,110 (GRCm39) missense probably benign
Z1176:Cdk5rap2 UTSW 4 70,184,980 (GRCm39) missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AACTTAGTGTGGCCCCAAC -3'
(R):5'- AGTGTCATGTAATCCCAGCTCC -3'

Sequencing Primer
(F):5'- AAGGTGGGGCACATTTCC -3'
(R):5'- CAGCTCCTGATCCTGAAACAGG -3'
Posted On 2018-04-02