Incidental Mutation 'R6326:Vmn1r181'
ID510406
Institutional Source Beutler Lab
Gene Symbol Vmn1r181
Ensembl Gene ENSMUSG00000097425
Gene Namevomeronasal 1 receptor 181
SynonymsV1rd20
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.055) question?
Stock #R6326 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location23974615-23988139 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 23984758 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glutamine at position 216 (R216Q)
Ref Sequence ENSEMBL: ENSMUSP00000154403 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000181796] [ENSMUST00000226843] [ENSMUST00000226978] [ENSMUST00000227637] [ENSMUST00000228399] [ENSMUST00000228842]
Predicted Effect probably benign
Transcript: ENSMUST00000181796
AA Change: R216Q

PolyPhen 2 Score 0.117 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000137685
Gene: ENSMUSG00000097425
AA Change: R216Q

DomainStartEndE-ValueType
Pfam:TAS2R 8 296 3.9e-9 PFAM
Pfam:V1R 41 295 2.7e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000226843
AA Change: R216Q

PolyPhen 2 Score 0.233 (Sensitivity: 0.91; Specificity: 0.88)
Predicted Effect probably benign
Transcript: ENSMUST00000226978
AA Change: R216Q

PolyPhen 2 Score 0.233 (Sensitivity: 0.91; Specificity: 0.88)
Predicted Effect probably benign
Transcript: ENSMUST00000227637
AA Change: R216Q

PolyPhen 2 Score 0.233 (Sensitivity: 0.91; Specificity: 0.88)
Predicted Effect probably benign
Transcript: ENSMUST00000228399
AA Change: R216Q

PolyPhen 2 Score 0.233 (Sensitivity: 0.91; Specificity: 0.88)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228531
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228607
Predicted Effect probably benign
Transcript: ENSMUST00000228842
AA Change: R216Q

PolyPhen 2 Score 0.233 (Sensitivity: 0.91; Specificity: 0.88)
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110032A03Rik T G 9: 50,764,757 N87T probably damaging Het
2810474O19Rik T A 6: 149,328,995 Y1180N probably damaging Het
Adamts17 A T 7: 67,120,888 Y915F probably benign Het
Adap2 T A 11: 80,155,022 F43I probably damaging Het
Adprhl2 A T 4: 126,316,613 L358Q possibly damaging Het
AI314180 T A 4: 58,827,068 T1022S probably benign Het
Akap9 A C 5: 3,962,061 Q921H probably damaging Het
Amigo2 A G 15: 97,245,375 S389P probably benign Het
Atg2b A T 12: 105,661,092 C545* probably null Het
C2cd3 A G 7: 100,416,428 E807G probably benign Het
Ccdc110 A G 8: 45,942,041 E323G probably damaging Het
Cdk5rap2 T A 4: 70,235,454 S1711C probably damaging Het
Cebpzos T G 17: 78,919,057 D39E probably damaging Het
Cenpe A G 3: 135,239,778 N1018D probably benign Het
Clspn C A 4: 126,565,739 H141Q probably damaging Het
Cluh C T 11: 74,666,242 A1010V probably benign Het
Col27a1 G T 4: 63,324,441 probably benign Het
Cpt2 T C 4: 107,914,316 M61V probably benign Het
Ddr2 T A 1: 169,987,140 H578L probably damaging Het
Dnah14 T A 1: 181,783,556 I3749N probably damaging Het
Dnajc18 T C 18: 35,680,925 T264A possibly damaging Het
Eml6 T C 11: 29,819,066 N693S probably damaging Het
Ephx4 A G 5: 107,406,111 E9G probably damaging Het
Eps15l1 G A 8: 72,341,434 Q747* probably null Het
Flrt1 C T 19: 7,096,609 S191N probably damaging Het
Gm5114 C T 7: 39,408,155 R680H probably benign Het
Gm5431 T C 11: 48,889,345 H250R probably damaging Het
Gm7233 T C 14: 43,182,885 C198R possibly damaging Het
Herc2 C G 7: 56,222,934 Q4407E probably damaging Het
Hmx3 C G 7: 131,543,005 probably benign Het
Hoxb7 C A 11: 96,287,083 A119E probably benign Het
Ifi207 A T 1: 173,729,966 M402K probably benign Het
Ints14 T C 9: 64,964,437 V19A probably benign Het
Itgae T A 11: 73,131,693 N911K possibly damaging Het
Kif1a T C 1: 93,076,326 S145G probably damaging Het
Klhdc4 A G 8: 121,805,054 W187R probably damaging Het
Krt1 A T 15: 101,850,249 I160N probably damaging Het
Krt12 T C 11: 99,416,919 T448A probably benign Het
Lcmt2 G A 2: 121,139,457 R382* probably null Het
Map3k8 C T 18: 4,340,651 S221N probably damaging Het
Med17 T C 9: 15,279,558 D79G probably benign Het
Mlf1 A T 3: 67,399,727 I257F probably damaging Het
Mov10l1 T A 15: 88,994,895 F153I probably damaging Het
Msto1 A C 3: 88,912,098 V149G probably damaging Het
Mybl1 T C 1: 9,678,507 probably null Het
Myoc A G 1: 162,649,011 Y428C probably damaging Het
Nin A G 12: 70,045,181 S785P possibly damaging Het
Oit3 A T 10: 59,428,239 F358I probably damaging Het
Olfr1095 C T 2: 86,850,994 V235I probably benign Het
Olfr794 A G 10: 129,570,702 T16A possibly damaging Het
Paip1 A G 13: 119,430,217 N29S probably benign Het
Pcdhgb4 T C 18: 37,722,456 S635P probably benign Het
Pcsk1 A G 13: 75,132,179 N708D possibly damaging Het
Plch1 C T 3: 63,781,390 W131* probably null Het
Prag1 A T 8: 36,102,706 M148L possibly damaging Het
Ptch1 A G 13: 63,543,545 L176P probably damaging Het
Ralgapa1 A T 12: 55,747,146 V568D probably damaging Het
Rb1 A T 14: 73,198,534 M897K probably benign Het
Robo3 T A 9: 37,427,027 Q386L probably damaging Het
Rtn4rl1 T C 11: 75,266,002 V420A possibly damaging Het
Sall1 A T 8: 89,030,268 N1069K probably benign Het
Sipa1l1 A G 12: 82,372,468 E640G probably damaging Het
Slc22a2 C A 17: 12,612,410 Y362* probably null Het
Slc5a9 T C 4: 111,880,253 E603G probably benign Het
Slc6a17 A T 3: 107,500,406 I83N probably damaging Het
Snx29 G T 16: 11,403,566 M285I probably benign Het
Spata2 T C 2: 167,484,174 T242A possibly damaging Het
Stard13 A G 5: 151,046,919 L733P possibly damaging Het
Svep1 A G 4: 58,073,045 V2088A possibly damaging Het
Tdp2 A G 13: 24,840,557 E279G probably damaging Het
Tnfrsf8 T G 4: 145,269,224 I422L probably damaging Het
Tpk1 T A 6: 43,346,802 T189S possibly damaging Het
Trhde A T 10: 114,567,224 M498K probably damaging Het
Trim35 T A 14: 66,303,204 H168Q possibly damaging Het
Tubb5 T C 17: 35,836,455 probably benign Het
Vmn2r77 G A 7: 86,801,823 G306R probably benign Het
Xkr4 C T 1: 3,671,038 R104H possibly damaging Het
Zcchc11 C T 4: 108,478,980 T6I probably benign Het
Zfp398 T C 6: 47,866,421 I337T possibly damaging Het
Other mutations in Vmn1r181
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01443:Vmn1r181 APN 7 23984581 missense possibly damaging 0.91
IGL02055:Vmn1r181 APN 7 23984553 missense probably damaging 1.00
IGL02444:Vmn1r181 APN 7 23984523 missense probably damaging 1.00
IGL03012:Vmn1r181 APN 7 23984602 missense probably damaging 0.98
IGL03026:Vmn1r181 APN 7 23984575 missense possibly damaging 0.94
R0255:Vmn1r181 UTSW 7 23984334 missense probably benign 0.02
R1481:Vmn1r181 UTSW 7 23984712 missense probably damaging 1.00
R2847:Vmn1r181 UTSW 7 23984518 missense possibly damaging 0.88
R2848:Vmn1r181 UTSW 7 23984518 missense possibly damaging 0.88
R2849:Vmn1r181 UTSW 7 23984518 missense possibly damaging 0.88
R3441:Vmn1r181 UTSW 7 23984883 missense probably benign 0.05
R3757:Vmn1r181 UTSW 7 23984484 missense possibly damaging 0.90
R3945:Vmn1r181 UTSW 7 23984152 missense probably damaging 0.98
R3983:Vmn1r181 UTSW 7 23984809 missense probably benign 0.23
R4780:Vmn1r181 UTSW 7 23984583 missense possibly damaging 0.64
R4999:Vmn1r181 UTSW 7 23984365 missense probably damaging 0.99
R5463:Vmn1r181 UTSW 7 23984362 missense probably benign 0.02
R5672:Vmn1r181 UTSW 7 23984316 missense probably damaging 1.00
R6229:Vmn1r181 UTSW 7 23984155 missense probably damaging 1.00
R6315:Vmn1r181 UTSW 7 23984758 missense probably benign 0.23
R6316:Vmn1r181 UTSW 7 23984758 missense probably benign 0.23
R6317:Vmn1r181 UTSW 7 23984758 missense probably benign 0.23
R6324:Vmn1r181 UTSW 7 23984758 missense probably benign 0.23
R6988:Vmn1r181 UTSW 7 23984847 missense probably damaging 1.00
R7446:Vmn1r181 UTSW 7 23984931 missense probably benign 0.01
R7972:Vmn1r181 UTSW 7 23984446 missense probably benign 0.30
R8465:Vmn1r181 UTSW 7 23984884 missense possibly damaging 0.65
X0067:Vmn1r181 UTSW 7 23984901 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AGTGTCCCGAATTTGGTGAG -3'
(R):5'- CAATGCCTCAGGAATTGGTG -3'

Sequencing Primer
(F):5'- ATTCCAATTAAGGTCACTGGTCCAC -3'
(R):5'- GACTACCAGCATCAGGAT -3'
Posted On2018-04-02