Incidental Mutation 'R6326:Adamts17'
ID510409
Institutional Source Beutler Lab
Gene Symbol Adamts17
Ensembl Gene ENSMUSG00000058145
Gene Namea disintegrin-like and metallopeptidase (reprolysin type) with thrombospondin type 1 motif, 17
SynonymsAU023434
MMRRC Submission
Accession Numbers

Genbank: NM_001033877; MGI: 3588195

Is this an essential gene? Probably non essential (E-score: 0.072) question?
Stock #R6326 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location66839735-67153171 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 67120888 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Phenylalanine at position 915 (Y915F)
Ref Sequence ENSEMBL: ENSMUSP00000095984 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098382] [ENSMUST00000107478]
Predicted Effect probably benign
Transcript: ENSMUST00000098382
AA Change: Y915F

PolyPhen 2 Score 0.053 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000095984
Gene: ENSMUSG00000058145
AA Change: Y915F

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Pfam:Pep_M12B_propep 35 179 2.9e-25 PFAM
Pfam:Reprolysin_5 228 422 3.1e-15 PFAM
Pfam:Reprolysin_2 248 440 6.1e-13 PFAM
Pfam:Reprolysin_3 252 398 2.2e-12 PFAM
Pfam:Reprolysin_4 328 446 7.1e-10 PFAM
Pfam:Reprolysin 334 450 2e-18 PFAM
Blast:ACR 454 533 3e-12 BLAST
TSP1 544 596 2.2e-15 SMART
Pfam:ADAM_spacer1 698 808 6.4e-30 PFAM
TSP1 829 887 1.81e-1 SMART
TSP1 889 942 1.15e-4 SMART
TSP1 949 993 4.05e-5 SMART
TSP1 1000 1054 2.91e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000107478
AA Change: Y888F

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000103102
Gene: ENSMUSG00000058145
AA Change: Y888F

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Pfam:Pep_M12B_propep 34 180 3.1e-23 PFAM
Pfam:Reprolysin_5 228 424 3.2e-15 PFAM
Pfam:Reprolysin_2 248 440 5.9e-11 PFAM
Pfam:Reprolysin_3 252 398 6e-12 PFAM
Pfam:Reprolysin_4 328 446 6.8e-10 PFAM
Pfam:Reprolysin 334 450 4.3e-21 PFAM
Blast:ACR 454 533 3e-12 BLAST
TSP1 544 596 2.2e-15 SMART
Pfam:ADAM_spacer1 700 781 2.2e-16 PFAM
TSP1 802 860 1.81e-1 SMART
TSP1 862 915 1.15e-4 SMART
TSP1 922 966 4.05e-5 SMART
TSP1 973 1027 2.91e-6 SMART
Pfam:PLAC 1046 1080 1.1e-10 PFAM
Meta Mutation Damage Score 0.0812 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the ADAMTS (a disintegrin and metalloproteinase with thrombospondin motifs) protein family. ADAMTS family members share several distinct protein modules, including a propeptide region, a metalloproteinase domain, a disintegrin-like domain, and a thrombospondin type 1 (TS) motif. Individual members of this family differ in the number of C-terminal TS motifs, and some have unique C-terminal domains. The encoded preproprotein is proteolytically processed to generate the mature protein, which may promote breast cancer cell growth and survival. Mutations in this gene are associated with a Weill-Marchesani-like syndrome, which is characterized by lenticular myopia, ectopia lentis, glaucoma, spherophakia, and short stature. [provided by RefSeq, May 2016]
Allele List at MGI

All alleles(3) : Targeted, other(2) Gene trapped(1)

Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110032A03Rik T G 9: 50,764,757 N87T probably damaging Het
2810474O19Rik T A 6: 149,328,995 Y1180N probably damaging Het
Adap2 T A 11: 80,155,022 F43I probably damaging Het
Adprhl2 A T 4: 126,316,613 L358Q possibly damaging Het
AI314180 T A 4: 58,827,068 T1022S probably benign Het
Akap9 A C 5: 3,962,061 Q921H probably damaging Het
Amigo2 A G 15: 97,245,375 S389P probably benign Het
Atg2b A T 12: 105,661,092 C545* probably null Het
C2cd3 A G 7: 100,416,428 E807G probably benign Het
Ccdc110 A G 8: 45,942,041 E323G probably damaging Het
Cdk5rap2 T A 4: 70,235,454 S1711C probably damaging Het
Cebpzos T G 17: 78,919,057 D39E probably damaging Het
Cenpe A G 3: 135,239,778 N1018D probably benign Het
Clspn C A 4: 126,565,739 H141Q probably damaging Het
Cluh C T 11: 74,666,242 A1010V probably benign Het
Col27a1 G T 4: 63,324,441 probably benign Het
Cpt2 T C 4: 107,914,316 M61V probably benign Het
Ddr2 T A 1: 169,987,140 H578L probably damaging Het
Dnah14 T A 1: 181,783,556 I3749N probably damaging Het
Dnajc18 T C 18: 35,680,925 T264A possibly damaging Het
Eml6 T C 11: 29,819,066 N693S probably damaging Het
Ephx4 A G 5: 107,406,111 E9G probably damaging Het
Eps15l1 G A 8: 72,341,434 Q747* probably null Het
Flrt1 C T 19: 7,096,609 S191N probably damaging Het
Gm5114 C T 7: 39,408,155 R680H probably benign Het
Gm5431 T C 11: 48,889,345 H250R probably damaging Het
Gm7233 T C 14: 43,182,885 C198R possibly damaging Het
Herc2 C G 7: 56,222,934 Q4407E probably damaging Het
Hmx3 C G 7: 131,543,005 probably benign Het
Hoxb7 C A 11: 96,287,083 A119E probably benign Het
Ifi207 A T 1: 173,729,966 M402K probably benign Het
Ints14 T C 9: 64,964,437 V19A probably benign Het
Itgae T A 11: 73,131,693 N911K possibly damaging Het
Kif1a T C 1: 93,076,326 S145G probably damaging Het
Klhdc4 A G 8: 121,805,054 W187R probably damaging Het
Krt1 A T 15: 101,850,249 I160N probably damaging Het
Krt12 T C 11: 99,416,919 T448A probably benign Het
Lcmt2 G A 2: 121,139,457 R382* probably null Het
Map3k8 C T 18: 4,340,651 S221N probably damaging Het
Med17 T C 9: 15,279,558 D79G probably benign Het
Mlf1 A T 3: 67,399,727 I257F probably damaging Het
Mov10l1 T A 15: 88,994,895 F153I probably damaging Het
Msto1 A C 3: 88,912,098 V149G probably damaging Het
Mybl1 T C 1: 9,678,507 probably null Het
Myoc A G 1: 162,649,011 Y428C probably damaging Het
Nin A G 12: 70,045,181 S785P possibly damaging Het
Oit3 A T 10: 59,428,239 F358I probably damaging Het
Olfr1095 C T 2: 86,850,994 V235I probably benign Het
Olfr794 A G 10: 129,570,702 T16A possibly damaging Het
Paip1 A G 13: 119,430,217 N29S probably benign Het
Pcdhgb4 T C 18: 37,722,456 S635P probably benign Het
Pcsk1 A G 13: 75,132,179 N708D possibly damaging Het
Plch1 C T 3: 63,781,390 W131* probably null Het
Prag1 A T 8: 36,102,706 M148L possibly damaging Het
Ptch1 A G 13: 63,543,545 L176P probably damaging Het
Ralgapa1 A T 12: 55,747,146 V568D probably damaging Het
Rb1 A T 14: 73,198,534 M897K probably benign Het
Robo3 T A 9: 37,427,027 Q386L probably damaging Het
Rtn4rl1 T C 11: 75,266,002 V420A possibly damaging Het
Sall1 A T 8: 89,030,268 N1069K probably benign Het
Sipa1l1 A G 12: 82,372,468 E640G probably damaging Het
Slc22a2 C A 17: 12,612,410 Y362* probably null Het
Slc5a9 T C 4: 111,880,253 E603G probably benign Het
Slc6a17 A T 3: 107,500,406 I83N probably damaging Het
Snx29 G T 16: 11,403,566 M285I probably benign Het
Spata2 T C 2: 167,484,174 T242A possibly damaging Het
Stard13 A G 5: 151,046,919 L733P possibly damaging Het
Svep1 A G 4: 58,073,045 V2088A possibly damaging Het
Tdp2 A G 13: 24,840,557 E279G probably damaging Het
Tnfrsf8 T G 4: 145,269,224 I422L probably damaging Het
Tpk1 T A 6: 43,346,802 T189S possibly damaging Het
Trhde A T 10: 114,567,224 M498K probably damaging Het
Trim35 T A 14: 66,303,204 H168Q possibly damaging Het
Tubb5 T C 17: 35,836,455 probably benign Het
Vmn1r181 G A 7: 23,984,758 R216Q probably benign Het
Vmn2r77 G A 7: 86,801,823 G306R probably benign Het
Xkr4 C T 1: 3,671,038 R104H possibly damaging Het
Zcchc11 C T 4: 108,478,980 T6I probably benign Het
Zfp398 T C 6: 47,866,421 I337T possibly damaging Het
Other mutations in Adamts17
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00708:Adamts17 APN 7 66968902 missense probably damaging 1.00
IGL00950:Adamts17 APN 7 67120912 missense possibly damaging 0.69
IGL01532:Adamts17 APN 7 66908601 missense probably damaging 1.00
IGL01591:Adamts17 APN 7 67004396 missense probably damaging 1.00
IGL01602:Adamts17 APN 7 66888411 missense probably benign 0.29
IGL01640:Adamts17 APN 7 67029680 missense probably damaging 0.98
IGL01686:Adamts17 APN 7 66840289 missense probably benign 0.06
IGL01747:Adamts17 APN 7 67052011 missense probably damaging 1.00
IGL02081:Adamts17 APN 7 67062110 missense probably damaging 1.00
IGL02152:Adamts17 APN 7 67125000 missense probably benign 0.01
IGL02264:Adamts17 APN 7 67047459 splice site probably null
IGL02457:Adamts17 APN 7 67027814 missense probably damaging 0.99
IGL02519:Adamts17 APN 7 67124973 missense possibly damaging 0.82
IGL02530:Adamts17 APN 7 66909376 missense probably damaging 1.00
IGL02649:Adamts17 APN 7 66849878 splice site probably benign
IGL02711:Adamts17 APN 7 67052040 splice site probably benign
IGL03006:Adamts17 APN 7 67078347 missense possibly damaging 0.53
IGL03203:Adamts17 APN 7 67062108 missense probably damaging 1.00
IGL03343:Adamts17 APN 7 67075316 missense probably damaging 1.00
BB007:Adamts17 UTSW 7 66849799 missense probably damaging 0.96
BB017:Adamts17 UTSW 7 66849799 missense probably damaging 0.96
E2594:Adamts17 UTSW 7 67004350 missense probably damaging 1.00
R0380:Adamts17 UTSW 7 67150044 missense probably benign 0.00
R0416:Adamts17 UTSW 7 66915898 splice site probably null
R0635:Adamts17 UTSW 7 66908605 missense probably damaging 1.00
R1083:Adamts17 UTSW 7 67147574 missense probably damaging 1.00
R1476:Adamts17 UTSW 7 67075343 missense probably damaging 1.00
R1728:Adamts17 UTSW 7 67149956 nonsense probably null
R1729:Adamts17 UTSW 7 67149956 nonsense probably null
R1763:Adamts17 UTSW 7 67147715 missense probably damaging 1.00
R1784:Adamts17 UTSW 7 67149956 nonsense probably null
R1905:Adamts17 UTSW 7 67047472 nonsense probably null
R1938:Adamts17 UTSW 7 67125072 missense probably damaging 1.00
R3106:Adamts17 UTSW 7 67125072 missense probably damaging 1.00
R3796:Adamts17 UTSW 7 66839914 splice site probably null
R3849:Adamts17 UTSW 7 66840467 missense possibly damaging 0.92
R3850:Adamts17 UTSW 7 66840467 missense possibly damaging 0.92
R3945:Adamts17 UTSW 7 67120939 missense probably benign
R4519:Adamts17 UTSW 7 66840566 missense probably damaging 0.99
R4554:Adamts17 UTSW 7 67027893 missense probably damaging 1.00
R4555:Adamts17 UTSW 7 67027893 missense probably damaging 1.00
R4556:Adamts17 UTSW 7 67027893 missense probably damaging 1.00
R4557:Adamts17 UTSW 7 67027893 missense probably damaging 1.00
R4700:Adamts17 UTSW 7 67041888 missense probably damaging 1.00
R4752:Adamts17 UTSW 7 67004470 missense probably damaging 0.96
R5019:Adamts17 UTSW 7 67062070 nonsense probably null
R5438:Adamts17 UTSW 7 66888417 missense probably benign 0.30
R5444:Adamts17 UTSW 7 67041899 missense probably benign 0.02
R5673:Adamts17 UTSW 7 67041807 missense probably damaging 1.00
R6964:Adamts17 UTSW 7 66909400 missense possibly damaging 0.93
R6964:Adamts17 UTSW 7 67004353 missense probably benign 0.00
R7129:Adamts17 UTSW 7 67121010 missense probably damaging 1.00
R7317:Adamts17 UTSW 7 66840556 nonsense probably null
R7355:Adamts17 UTSW 7 67075304 missense
R7386:Adamts17 UTSW 7 66968849 missense probably benign 0.25
R7407:Adamts17 UTSW 7 67047556 nonsense probably null
R7432:Adamts17 UTSW 7 67051917 missense
R7782:Adamts17 UTSW 7 67125054 missense probably damaging 1.00
R7817:Adamts17 UTSW 7 66909476 missense probably damaging 0.99
R7930:Adamts17 UTSW 7 66849799 missense probably damaging 0.96
R7993:Adamts17 UTSW 7 66849864 missense possibly damaging 0.90
R8178:Adamts17 UTSW 7 66849716 missense possibly damaging 0.46
R8962:Adamts17 UTSW 7 67075309 missense probably damaging 1.00
X0022:Adamts17 UTSW 7 67041901 missense probably benign 0.44
Predicted Primers PCR Primer
(F):5'- AGATGACAGCTCTGGCCATTC -3'
(R):5'- GGTTAAGGCCTTCAGGTTCTCG -3'

Sequencing Primer
(F):5'- GTTTGAAGCTCTGGAATTATCTCC -3'
(R):5'- GCATGGCTTCCACTTCAGTG -3'
Posted On2018-04-02