Incidental Mutation 'R6326:Klhdc4'
ID510417
Institutional Source Beutler Lab
Gene Symbol Klhdc4
Ensembl Gene ENSMUSG00000040263
Gene Namekelch domain containing 4
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.180) question?
Stock #R6326 (G1)
Quality Score225.009
Status Not validated
Chromosome8
Chromosomal Location121796313-121829569 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 121805054 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Arginine at position 187 (W187R)
Ref Sequence ENSEMBL: ENSMUSP00000134361 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045884] [ENSMUST00000127664] [ENSMUST00000174192] [ENSMUST00000174665] [ENSMUST00000174717]
Predicted Effect probably damaging
Transcript: ENSMUST00000045884
AA Change: W218R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000043439
Gene: ENSMUSG00000040263
AA Change: W218R

DomainStartEndE-ValueType
low complexity region 2 20 N/A INTRINSIC
low complexity region 22 34 N/A INTRINSIC
Pfam:Kelch_4 63 118 8.3e-11 PFAM
Pfam:Kelch_3 75 125 1.7e-9 PFAM
Pfam:Kelch_6 118 174 2.4e-9 PFAM
Pfam:Kelch_4 118 175 3e-8 PFAM
Pfam:Kelch_3 131 185 2e-8 PFAM
Pfam:Kelch_5 173 216 7.5e-9 PFAM
Pfam:Kelch_3 186 239 2.1e-6 PFAM
Pfam:Kelch_1 295 345 4.6e-6 PFAM
Pfam:Kelch_2 295 349 2.1e-7 PFAM
low complexity region 489 520 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000127664
SMART Domains Protein: ENSMUSP00000118564
Gene: ENSMUSG00000092329

DomainStartEndE-ValueType
Pfam:Glycos_transf_2 104 287 7.4e-31 PFAM
Pfam:Glyco_transf_7C 261 331 4.9e-8 PFAM
RICIN 406 531 9.28e-27 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172507
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172954
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173993
Predicted Effect probably damaging
Transcript: ENSMUST00000174192
AA Change: W161R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000134487
Gene: ENSMUSG00000040263
AA Change: W161R

DomainStartEndE-ValueType
Pfam:Kelch_3 32 70 1.5e-6 PFAM
Pfam:Kelch_6 61 117 1.9e-8 PFAM
Pfam:Kelch_4 61 118 6.9e-8 PFAM
Pfam:Kelch_3 74 128 4.6e-8 PFAM
Pfam:Kelch_5 116 159 1.4e-7 PFAM
Pfam:Kelch_4 119 172 2.2e-6 PFAM
Pfam:Kelch_3 129 182 7e-7 PFAM
Pfam:Kelch_2 238 292 1.8e-7 PFAM
low complexity region 432 463 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000174665
SMART Domains Protein: ENSMUSP00000134474
Gene: ENSMUSG00000040263

DomainStartEndE-ValueType
low complexity region 2 20 N/A INTRINSIC
low complexity region 22 34 N/A INTRINSIC
low complexity region 57 67 N/A INTRINSIC
low complexity region 104 114 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174709
Predicted Effect probably damaging
Transcript: ENSMUST00000174717
AA Change: W187R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000134361
Gene: ENSMUSG00000040263
AA Change: W187R

DomainStartEndE-ValueType
low complexity region 2 20 N/A INTRINSIC
low complexity region 22 34 N/A INTRINSIC
Pfam:Kelch_4 63 117 1.4e-8 PFAM
Pfam:Kelch_3 75 127 9.6e-11 PFAM
Pfam:Kelch_4 118 170 2.3e-7 PFAM
Pfam:Kelch_6 118 174 9.3e-9 PFAM
low complexity region 191 202 N/A INTRINSIC
Pfam:Kelch_2 264 318 2e-7 PFAM
low complexity region 458 489 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110032A03Rik T G 9: 50,764,757 N87T probably damaging Het
2810474O19Rik T A 6: 149,328,995 Y1180N probably damaging Het
Adamts17 A T 7: 67,120,888 Y915F probably benign Het
Adap2 T A 11: 80,155,022 F43I probably damaging Het
Adprhl2 A T 4: 126,316,613 L358Q possibly damaging Het
AI314180 T A 4: 58,827,068 T1022S probably benign Het
Akap9 A C 5: 3,962,061 Q921H probably damaging Het
Amigo2 A G 15: 97,245,375 S389P probably benign Het
Atg2b A T 12: 105,661,092 C545* probably null Het
C2cd3 A G 7: 100,416,428 E807G probably benign Het
Ccdc110 A G 8: 45,942,041 E323G probably damaging Het
Cdk5rap2 T A 4: 70,235,454 S1711C probably damaging Het
Cebpzos T G 17: 78,919,057 D39E probably damaging Het
Cenpe A G 3: 135,239,778 N1018D probably benign Het
Clspn C A 4: 126,565,739 H141Q probably damaging Het
Cluh C T 11: 74,666,242 A1010V probably benign Het
Col27a1 G T 4: 63,324,441 probably benign Het
Cpt2 T C 4: 107,914,316 M61V probably benign Het
Ddr2 T A 1: 169,987,140 H578L probably damaging Het
Dnah14 T A 1: 181,783,556 I3749N probably damaging Het
Dnajc18 T C 18: 35,680,925 T264A possibly damaging Het
Eml6 T C 11: 29,819,066 N693S probably damaging Het
Ephx4 A G 5: 107,406,111 E9G probably damaging Het
Eps15l1 G A 8: 72,341,434 Q747* probably null Het
Flrt1 C T 19: 7,096,609 S191N probably damaging Het
Gm5114 C T 7: 39,408,155 R680H probably benign Het
Gm5431 T C 11: 48,889,345 H250R probably damaging Het
Gm7233 T C 14: 43,182,885 C198R possibly damaging Het
Herc2 C G 7: 56,222,934 Q4407E probably damaging Het
Hmx3 C G 7: 131,543,005 probably benign Het
Hoxb7 C A 11: 96,287,083 A119E probably benign Het
Ifi207 A T 1: 173,729,966 M402K probably benign Het
Ints14 T C 9: 64,964,437 V19A probably benign Het
Itgae T A 11: 73,131,693 N911K possibly damaging Het
Kif1a T C 1: 93,076,326 S145G probably damaging Het
Krt1 A T 15: 101,850,249 I160N probably damaging Het
Krt12 T C 11: 99,416,919 T448A probably benign Het
Lcmt2 G A 2: 121,139,457 R382* probably null Het
Map3k8 C T 18: 4,340,651 S221N probably damaging Het
Med17 T C 9: 15,279,558 D79G probably benign Het
Mlf1 A T 3: 67,399,727 I257F probably damaging Het
Mov10l1 T A 15: 88,994,895 F153I probably damaging Het
Msto1 A C 3: 88,912,098 V149G probably damaging Het
Mybl1 T C 1: 9,678,507 probably null Het
Myoc A G 1: 162,649,011 Y428C probably damaging Het
Nin A G 12: 70,045,181 S785P possibly damaging Het
Oit3 A T 10: 59,428,239 F358I probably damaging Het
Olfr1095 C T 2: 86,850,994 V235I probably benign Het
Olfr794 A G 10: 129,570,702 T16A possibly damaging Het
Paip1 A G 13: 119,430,217 N29S probably benign Het
Pcdhgb4 T C 18: 37,722,456 S635P probably benign Het
Pcsk1 A G 13: 75,132,179 N708D possibly damaging Het
Plch1 C T 3: 63,781,390 W131* probably null Het
Prag1 A T 8: 36,102,706 M148L possibly damaging Het
Ptch1 A G 13: 63,543,545 L176P probably damaging Het
Ralgapa1 A T 12: 55,747,146 V568D probably damaging Het
Rb1 A T 14: 73,198,534 M897K probably benign Het
Robo3 T A 9: 37,427,027 Q386L probably damaging Het
Rtn4rl1 T C 11: 75,266,002 V420A possibly damaging Het
Sall1 A T 8: 89,030,268 N1069K probably benign Het
Sipa1l1 A G 12: 82,372,468 E640G probably damaging Het
Slc22a2 C A 17: 12,612,410 Y362* probably null Het
Slc5a9 T C 4: 111,880,253 E603G probably benign Het
Slc6a17 A T 3: 107,500,406 I83N probably damaging Het
Snx29 G T 16: 11,403,566 M285I probably benign Het
Spata2 T C 2: 167,484,174 T242A possibly damaging Het
Stard13 A G 5: 151,046,919 L733P possibly damaging Het
Svep1 A G 4: 58,073,045 V2088A possibly damaging Het
Tdp2 A G 13: 24,840,557 E279G probably damaging Het
Tnfrsf8 T G 4: 145,269,224 I422L probably damaging Het
Tpk1 T A 6: 43,346,802 T189S possibly damaging Het
Trhde A T 10: 114,567,224 M498K probably damaging Het
Trim35 T A 14: 66,303,204 H168Q possibly damaging Het
Tubb5 T C 17: 35,836,455 probably benign Het
Vmn1r181 G A 7: 23,984,758 R216Q probably benign Het
Vmn2r77 G A 7: 86,801,823 G306R probably benign Het
Xkr4 C T 1: 3,671,038 R104H possibly damaging Het
Zcchc11 C T 4: 108,478,980 T6I probably benign Het
Zfp398 T C 6: 47,866,421 I337T possibly damaging Het
Other mutations in Klhdc4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01100:Klhdc4 APN 8 121821843 nonsense probably null
IGL01678:Klhdc4 APN 8 121796938 missense possibly damaging 0.73
kilimanjaro UTSW 8 121813790 nonsense probably null
R0577:Klhdc4 UTSW 8 121821351 missense probably damaging 0.99
R0881:Klhdc4 UTSW 8 121799487 nonsense probably null
R1710:Klhdc4 UTSW 8 121799487 nonsense probably null
R2993:Klhdc4 UTSW 8 121806581 nonsense probably null
R3028:Klhdc4 UTSW 8 121799549 missense probably damaging 1.00
R3109:Klhdc4 UTSW 8 121821334 missense probably damaging 1.00
R3711:Klhdc4 UTSW 8 121798055 missense probably benign
R4132:Klhdc4 UTSW 8 121798065 missense possibly damaging 0.79
R4601:Klhdc4 UTSW 8 121799527 missense probably damaging 1.00
R4644:Klhdc4 UTSW 8 121822000 intron probably benign
R4758:Klhdc4 UTSW 8 121798044 missense probably benign 0.00
R4999:Klhdc4 UTSW 8 121796603 missense probably benign 0.00
R5177:Klhdc4 UTSW 8 121813790 nonsense probably null
R5364:Klhdc4 UTSW 8 121806636 intron probably benign
R5475:Klhdc4 UTSW 8 121799572 missense possibly damaging 0.67
R5705:Klhdc4 UTSW 8 121804993 missense probably benign 0.01
R6248:Klhdc4 UTSW 8 121813768 missense probably damaging 1.00
R6626:Klhdc4 UTSW 8 121820162 missense probably benign 0.43
R7274:Klhdc4 UTSW 8 121799658 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- TCAGAGAAAGCCGCTCACAG -3'
(R):5'- GGTAAGCTCTCCTGTGTCTG -3'

Sequencing Primer
(F):5'- GCCGCTCACAGCTCACAG -3'
(R):5'- GGCTTTTTATCCTTTTGTAAATGCAG -3'
Posted On2018-04-02