Incidental Mutation 'R6326:Med17'
ID510418
Institutional Source Beutler Lab
Gene Symbol Med17
Ensembl Gene ENSMUSG00000031935
Gene Namemediator complex subunit 17
SynonymsTrap80, C330002H14Rik, Crsp6
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.968) question?
Stock #R6326 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location15260351-15279931 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 15279558 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 79 (D79G)
Ref Sequence ENSEMBL: ENSMUSP00000150968 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034411] [ENSMUST00000034414] [ENSMUST00000178977] [ENSMUST00000180339] [ENSMUST00000216406] [ENSMUST00000216955]
Predicted Effect probably benign
Transcript: ENSMUST00000034411
AA Change: D79G

PolyPhen 2 Score 0.303 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000034411
Gene: ENSMUSG00000031935
AA Change: D79G

DomainStartEndE-ValueType
low complexity region 51 82 N/A INTRINSIC
Pfam:Med17 123 452 8.5e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000034414
SMART Domains Protein: ENSMUSP00000034414
Gene: ENSMUSG00000031938

DomainStartEndE-ValueType
DUF1907 19 303 3.83e-200 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000178977
SMART Domains Protein: ENSMUSP00000136335
Gene: ENSMUSG00000031938

DomainStartEndE-ValueType
DUF1907 19 303 3.83e-200 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000180339
SMART Domains Protein: ENSMUSP00000136717
Gene: ENSMUSG00000031938

DomainStartEndE-ValueType
DUF1907 19 303 3.83e-200 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000216406
AA Change: D79G

PolyPhen 2 Score 0.321 (Sensitivity: 0.90; Specificity: 0.89)
Predicted Effect probably benign
Transcript: ENSMUST00000216955
Meta Mutation Damage Score 0.2077 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The activation of gene transcription is a multistep process that is triggered by factors that recognize transcriptional enhancer sites in DNA. These factors work with co-activators to direct transcriptional initiation by the RNA polymerase II apparatus. The protein encoded by this gene is a subunit of the CRSP (cofactor required for SP1 activation) complex, which, along with TFIID, is required for efficient activation by SP1. This protein is also a component of other multisubunit complexes e.g. thyroid hormone receptor-(TR-) associated proteins which interact with TR and facilitate TR function on DNA templates in conjunction with initiation factors and cofactors. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110032A03Rik T G 9: 50,764,757 N87T probably damaging Het
2810474O19Rik T A 6: 149,328,995 Y1180N probably damaging Het
Adamts17 A T 7: 67,120,888 Y915F probably benign Het
Adap2 T A 11: 80,155,022 F43I probably damaging Het
Adprhl2 A T 4: 126,316,613 L358Q possibly damaging Het
AI314180 T A 4: 58,827,068 T1022S probably benign Het
Akap9 A C 5: 3,962,061 Q921H probably damaging Het
Amigo2 A G 15: 97,245,375 S389P probably benign Het
Atg2b A T 12: 105,661,092 C545* probably null Het
C2cd3 A G 7: 100,416,428 E807G probably benign Het
Ccdc110 A G 8: 45,942,041 E323G probably damaging Het
Cdk5rap2 T A 4: 70,235,454 S1711C probably damaging Het
Cebpzos T G 17: 78,919,057 D39E probably damaging Het
Cenpe A G 3: 135,239,778 N1018D probably benign Het
Clspn C A 4: 126,565,739 H141Q probably damaging Het
Cluh C T 11: 74,666,242 A1010V probably benign Het
Col27a1 G T 4: 63,324,441 probably benign Het
Cpt2 T C 4: 107,914,316 M61V probably benign Het
Ddr2 T A 1: 169,987,140 H578L probably damaging Het
Dnah14 T A 1: 181,783,556 I3749N probably damaging Het
Dnajc18 T C 18: 35,680,925 T264A possibly damaging Het
Eml6 T C 11: 29,819,066 N693S probably damaging Het
Ephx4 A G 5: 107,406,111 E9G probably damaging Het
Eps15l1 G A 8: 72,341,434 Q747* probably null Het
Flrt1 C T 19: 7,096,609 S191N probably damaging Het
Gm5114 C T 7: 39,408,155 R680H probably benign Het
Gm5431 T C 11: 48,889,345 H250R probably damaging Het
Gm7233 T C 14: 43,182,885 C198R possibly damaging Het
Herc2 C G 7: 56,222,934 Q4407E probably damaging Het
Hmx3 C G 7: 131,543,005 probably benign Het
Hoxb7 C A 11: 96,287,083 A119E probably benign Het
Ifi207 A T 1: 173,729,966 M402K probably benign Het
Ints14 T C 9: 64,964,437 V19A probably benign Het
Itgae T A 11: 73,131,693 N911K possibly damaging Het
Kif1a T C 1: 93,076,326 S145G probably damaging Het
Klhdc4 A G 8: 121,805,054 W187R probably damaging Het
Krt1 A T 15: 101,850,249 I160N probably damaging Het
Krt12 T C 11: 99,416,919 T448A probably benign Het
Lcmt2 G A 2: 121,139,457 R382* probably null Het
Map3k8 C T 18: 4,340,651 S221N probably damaging Het
Mlf1 A T 3: 67,399,727 I257F probably damaging Het
Mov10l1 T A 15: 88,994,895 F153I probably damaging Het
Msto1 A C 3: 88,912,098 V149G probably damaging Het
Mybl1 T C 1: 9,678,507 probably null Het
Myoc A G 1: 162,649,011 Y428C probably damaging Het
Nin A G 12: 70,045,181 S785P possibly damaging Het
Oit3 A T 10: 59,428,239 F358I probably damaging Het
Olfr1095 C T 2: 86,850,994 V235I probably benign Het
Olfr794 A G 10: 129,570,702 T16A possibly damaging Het
Paip1 A G 13: 119,430,217 N29S probably benign Het
Pcdhgb4 T C 18: 37,722,456 S635P probably benign Het
Pcsk1 A G 13: 75,132,179 N708D possibly damaging Het
Plch1 C T 3: 63,781,390 W131* probably null Het
Prag1 A T 8: 36,102,706 M148L possibly damaging Het
Ptch1 A G 13: 63,543,545 L176P probably damaging Het
Ralgapa1 A T 12: 55,747,146 V568D probably damaging Het
Rb1 A T 14: 73,198,534 M897K probably benign Het
Robo3 T A 9: 37,427,027 Q386L probably damaging Het
Rtn4rl1 T C 11: 75,266,002 V420A possibly damaging Het
Sall1 A T 8: 89,030,268 N1069K probably benign Het
Sipa1l1 A G 12: 82,372,468 E640G probably damaging Het
Slc22a2 C A 17: 12,612,410 Y362* probably null Het
Slc5a9 T C 4: 111,880,253 E603G probably benign Het
Slc6a17 A T 3: 107,500,406 I83N probably damaging Het
Snx29 G T 16: 11,403,566 M285I probably benign Het
Spata2 T C 2: 167,484,174 T242A possibly damaging Het
Stard13 A G 5: 151,046,919 L733P possibly damaging Het
Svep1 A G 4: 58,073,045 V2088A possibly damaging Het
Tdp2 A G 13: 24,840,557 E279G probably damaging Het
Tnfrsf8 T G 4: 145,269,224 I422L probably damaging Het
Tpk1 T A 6: 43,346,802 T189S possibly damaging Het
Trhde A T 10: 114,567,224 M498K probably damaging Het
Trim35 T A 14: 66,303,204 H168Q possibly damaging Het
Tubb5 T C 17: 35,836,455 probably benign Het
Vmn1r181 G A 7: 23,984,758 R216Q probably benign Het
Vmn2r77 G A 7: 86,801,823 G306R probably benign Het
Xkr4 C T 1: 3,671,038 R104H possibly damaging Het
Zcchc11 C T 4: 108,478,980 T6I probably benign Het
Zfp398 T C 6: 47,866,421 I337T possibly damaging Het
Other mutations in Med17
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01062:Med17 APN 9 15279621 missense probably benign 0.19
IGL02263:Med17 APN 9 15267476 missense probably damaging 0.98
IGL02390:Med17 APN 9 15277667 nonsense probably null
IGL02391:Med17 APN 9 15277667 nonsense probably null
IGL02392:Med17 APN 9 15277667 nonsense probably null
IGL02393:Med17 APN 9 15277667 nonsense probably null
IGL02591:Med17 APN 9 15270361 missense probably damaging 1.00
IGL02635:Med17 APN 9 15274549 missense probably damaging 1.00
IGL02745:Med17 APN 9 15265346 splice site probably benign
IGL02815:Med17 APN 9 15262267 missense probably damaging 1.00
IGL02897:Med17 APN 9 15267534 missense probably damaging 1.00
R1448:Med17 UTSW 9 15275843 splice site probably null
R2912:Med17 UTSW 9 15275914 missense probably damaging 1.00
R2937:Med17 UTSW 9 15275891 missense probably damaging 0.99
R3715:Med17 UTSW 9 15263766 splice site probably benign
R4175:Med17 UTSW 9 15267469 missense possibly damaging 0.93
R4557:Med17 UTSW 9 15271697 missense possibly damaging 0.86
R4701:Med17 UTSW 9 15270360 missense probably damaging 1.00
R4865:Med17 UTSW 9 15265372 nonsense probably null
R5169:Med17 UTSW 9 15277604 missense probably benign 0.03
R5510:Med17 UTSW 9 15270404 missense probably benign
R6393:Med17 UTSW 9 15274583 missense probably damaging 1.00
R6598:Med17 UTSW 9 15271700 missense probably benign 0.29
R7722:Med17 UTSW 9 15271691 missense probably benign 0.01
R8181:Med17 UTSW 9 15277632 missense possibly damaging 0.75
Predicted Primers PCR Primer
(F):5'- TTCACCTCAAAGTTTCAGTGGTC -3'
(R):5'- TGCTGTACTCTGAGTCTCCG -3'

Sequencing Primer
(F):5'- CAGTGGTCATTTTAAGTATCACCTG -3'
(R):5'- TGCGCATCAGCATCGAGTC -3'
Posted On2018-04-02