Incidental Mutation 'R6326:Oit3'
ID 510422
Institutional Source Beutler Lab
Gene Symbol Oit3
Ensembl Gene ENSMUSG00000009654
Gene Name oncoprotein induced transcript 3
Synonyms EF-9
MMRRC Submission 044480-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.420) question?
Stock # R6326 (G1)
Quality Score 225.009
Status Not validated
Chromosome 10
Chromosomal Location 59258782-59277601 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 59264061 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Isoleucine at position 358 (F358I)
Ref Sequence ENSEMBL: ENSMUSP00000009798 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000009798]
AlphaFold Q8R4V5
Predicted Effect probably damaging
Transcript: ENSMUST00000009798
AA Change: F358I

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000009798
Gene: ENSMUSG00000009654
AA Change: F358I

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Blast:ZP 50 144 9e-24 BLAST
EGF 150 181 2.16e1 SMART
EGF 185 222 2.94e-3 SMART
EGF 226 263 2.35e-2 SMART
ZP 267 516 2.74e-30 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162493
Meta Mutation Damage Score 0.4440 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene was identified due to its downregulation in hepatocarcinomas. The encoded protein may be involved in liver development and function. [provided by RefSeq, Sep 2016]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit decreased bloord uric acid, increased urine uric acid and polyuria. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts17 A T 7: 66,770,636 (GRCm39) Y915F probably benign Het
Adap2 T A 11: 80,045,848 (GRCm39) F43I probably damaging Het
Adprs A T 4: 126,210,406 (GRCm39) L358Q possibly damaging Het
Akap9 A C 5: 4,012,061 (GRCm39) Q921H probably damaging Het
Amigo2 A G 15: 97,143,256 (GRCm39) S389P probably benign Het
Atg2b A T 12: 105,627,351 (GRCm39) C545* probably null Het
C2cd3 A G 7: 100,065,635 (GRCm39) E807G probably benign Het
Ccdc110 A G 8: 46,395,078 (GRCm39) E323G probably damaging Het
Cdk5rap2 T A 4: 70,153,691 (GRCm39) S1711C probably damaging Het
Cebpzos T G 17: 79,226,486 (GRCm39) D39E probably damaging Het
Cenpe A G 3: 134,945,539 (GRCm39) N1018D probably benign Het
Cfap68 T G 9: 50,676,057 (GRCm39) N87T probably damaging Het
Clspn C A 4: 126,459,532 (GRCm39) H141Q probably damaging Het
Cluh C T 11: 74,557,068 (GRCm39) A1010V probably benign Het
Col27a1 G T 4: 63,242,678 (GRCm39) probably benign Het
Cpt2 T C 4: 107,771,513 (GRCm39) M61V probably benign Het
Ddr2 T A 1: 169,814,709 (GRCm39) H578L probably damaging Het
Dnah14 T A 1: 181,611,121 (GRCm39) I3749N probably damaging Het
Dnajc18 T C 18: 35,813,978 (GRCm39) T264A possibly damaging Het
Ecpas T A 4: 58,827,068 (GRCm39) T1022S probably benign Het
Eml6 T C 11: 29,769,066 (GRCm39) N693S probably damaging Het
Ephx4 A G 5: 107,553,977 (GRCm39) E9G probably damaging Het
Eps15l1 G A 8: 73,095,278 (GRCm39) Q747* probably null Het
Flrt1 C T 19: 7,073,974 (GRCm39) S191N probably damaging Het
Gm5114 C T 7: 39,057,579 (GRCm39) R680H probably benign Het
Gm5431 T C 11: 48,780,172 (GRCm39) H250R probably damaging Het
Gm7233 T C 14: 43,040,342 (GRCm39) C198R possibly damaging Het
Herc2 C G 7: 55,872,682 (GRCm39) Q4407E probably damaging Het
Hmx3 C G 7: 131,144,734 (GRCm39) probably benign Het
Hoxb7 C A 11: 96,177,909 (GRCm39) A119E probably benign Het
Ifi207 A T 1: 173,557,532 (GRCm39) M402K probably benign Het
Ints14 T C 9: 64,871,719 (GRCm39) V19A probably benign Het
Itgae T A 11: 73,022,519 (GRCm39) N911K possibly damaging Het
Kif1a T C 1: 93,004,048 (GRCm39) S145G probably damaging Het
Klhdc4 A G 8: 122,531,793 (GRCm39) W187R probably damaging Het
Krt1 A T 15: 101,758,684 (GRCm39) I160N probably damaging Het
Krt12 T C 11: 99,307,745 (GRCm39) T448A probably benign Het
Lcmt2 G A 2: 120,969,938 (GRCm39) R382* probably null Het
Map3k8 C T 18: 4,340,651 (GRCm39) S221N probably damaging Het
Med17 T C 9: 15,190,854 (GRCm39) D79G probably benign Het
Mlf1 A T 3: 67,307,060 (GRCm39) I257F probably damaging Het
Mov10l1 T A 15: 88,879,098 (GRCm39) F153I probably damaging Het
Msto1 A C 3: 88,819,405 (GRCm39) V149G probably damaging Het
Mybl1 T C 1: 9,748,732 (GRCm39) probably null Het
Myoc A G 1: 162,476,580 (GRCm39) Y428C probably damaging Het
Nin A G 12: 70,091,955 (GRCm39) S785P possibly damaging Het
Or5t15 C T 2: 86,681,338 (GRCm39) V235I probably benign Het
Or6c88 A G 10: 129,406,571 (GRCm39) T16A possibly damaging Het
Paip1 A G 13: 119,566,753 (GRCm39) N29S probably benign Het
Pcdhgb4 T C 18: 37,855,509 (GRCm39) S635P probably benign Het
Pcsk1 A G 13: 75,280,298 (GRCm39) N708D possibly damaging Het
Plch1 C T 3: 63,688,811 (GRCm39) W131* probably null Het
Prag1 A T 8: 36,569,860 (GRCm39) M148L possibly damaging Het
Ptch1 A G 13: 63,691,359 (GRCm39) L176P probably damaging Het
Ralgapa1 A T 12: 55,793,931 (GRCm39) V568D probably damaging Het
Rb1 A T 14: 73,435,974 (GRCm39) M897K probably benign Het
Resf1 T A 6: 149,230,493 (GRCm39) Y1180N probably damaging Het
Robo3 T A 9: 37,338,323 (GRCm39) Q386L probably damaging Het
Rtn4rl1 T C 11: 75,156,828 (GRCm39) V420A possibly damaging Het
Sall1 A T 8: 89,756,896 (GRCm39) N1069K probably benign Het
Sipa1l1 A G 12: 82,419,242 (GRCm39) E640G probably damaging Het
Slc22a2 C A 17: 12,831,297 (GRCm39) Y362* probably null Het
Slc5a9 T C 4: 111,737,450 (GRCm39) E603G probably benign Het
Slc6a17 A T 3: 107,407,722 (GRCm39) I83N probably damaging Het
Snx29 G T 16: 11,221,430 (GRCm39) M285I probably benign Het
Spata2 T C 2: 167,326,094 (GRCm39) T242A possibly damaging Het
Stard13 A G 5: 150,970,384 (GRCm39) L733P possibly damaging Het
Svep1 A G 4: 58,073,045 (GRCm39) V2088A possibly damaging Het
Tdp2 A G 13: 25,024,540 (GRCm39) E279G probably damaging Het
Tnfrsf8 T G 4: 144,995,794 (GRCm39) I422L probably damaging Het
Tpk1 T A 6: 43,323,736 (GRCm39) T189S possibly damaging Het
Trhde A T 10: 114,403,129 (GRCm39) M498K probably damaging Het
Trim35 T A 14: 66,540,653 (GRCm39) H168Q possibly damaging Het
Tubb5 T C 17: 36,147,347 (GRCm39) probably benign Het
Tut4 C T 4: 108,336,177 (GRCm39) T6I probably benign Het
Vmn1r181 G A 7: 23,684,183 (GRCm39) R216Q probably benign Het
Vmn2r77 G A 7: 86,451,031 (GRCm39) G306R probably benign Het
Xkr4 C T 1: 3,741,261 (GRCm39) R104H possibly damaging Het
Zfp398 T C 6: 47,843,355 (GRCm39) I337T possibly damaging Het
Other mutations in Oit3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01457:Oit3 APN 10 59,261,306 (GRCm39) unclassified probably benign
IGL01665:Oit3 APN 10 59,274,731 (GRCm39) missense probably damaging 1.00
IGL01839:Oit3 APN 10 59,265,318 (GRCm39) missense probably damaging 0.98
IGL02028:Oit3 APN 10 59,274,477 (GRCm39) missense probably damaging 0.98
PIT4585001:Oit3 UTSW 10 59,266,835 (GRCm39) missense possibly damaging 0.54
R0567:Oit3 UTSW 10 59,271,800 (GRCm39) missense probably damaging 0.99
R0781:Oit3 UTSW 10 59,264,016 (GRCm39) missense probably damaging 1.00
R1110:Oit3 UTSW 10 59,264,016 (GRCm39) missense probably damaging 1.00
R1563:Oit3 UTSW 10 59,263,896 (GRCm39) missense probably damaging 1.00
R1623:Oit3 UTSW 10 59,264,061 (GRCm39) missense probably damaging 0.99
R1693:Oit3 UTSW 10 59,261,239 (GRCm39) missense probably damaging 1.00
R1754:Oit3 UTSW 10 59,263,762 (GRCm39) splice site probably null
R1853:Oit3 UTSW 10 59,277,444 (GRCm39) critical splice donor site probably null
R2070:Oit3 UTSW 10 59,266,835 (GRCm39) missense probably benign 0.03
R2211:Oit3 UTSW 10 59,263,892 (GRCm39) missense probably damaging 1.00
R2516:Oit3 UTSW 10 59,277,507 (GRCm39) start gained probably benign
R2516:Oit3 UTSW 10 59,264,167 (GRCm39) missense probably damaging 1.00
R3103:Oit3 UTSW 10 59,274,713 (GRCm39) missense probably damaging 0.98
R4414:Oit3 UTSW 10 59,263,925 (GRCm39) missense probably damaging 1.00
R4415:Oit3 UTSW 10 59,263,925 (GRCm39) missense probably damaging 1.00
R4416:Oit3 UTSW 10 59,263,925 (GRCm39) missense probably damaging 1.00
R4417:Oit3 UTSW 10 59,263,925 (GRCm39) missense probably damaging 1.00
R4584:Oit3 UTSW 10 59,261,284 (GRCm39) missense probably damaging 1.00
R4734:Oit3 UTSW 10 59,259,904 (GRCm39) missense probably damaging 0.99
R4748:Oit3 UTSW 10 59,259,904 (GRCm39) missense probably damaging 0.99
R4749:Oit3 UTSW 10 59,259,904 (GRCm39) missense probably damaging 0.99
R5070:Oit3 UTSW 10 59,259,849 (GRCm39) missense probably damaging 1.00
R5521:Oit3 UTSW 10 59,271,736 (GRCm39) missense probably benign
R6490:Oit3 UTSW 10 59,274,374 (GRCm39) missense possibly damaging 0.92
R6526:Oit3 UTSW 10 59,265,462 (GRCm39) missense probably damaging 1.00
R6766:Oit3 UTSW 10 59,274,534 (GRCm39) missense probably damaging 0.99
R6921:Oit3 UTSW 10 59,271,767 (GRCm39) missense probably damaging 0.99
R7129:Oit3 UTSW 10 59,264,166 (GRCm39) missense probably damaging 0.99
R7440:Oit3 UTSW 10 59,265,392 (GRCm39) missense probably damaging 0.99
R7495:Oit3 UTSW 10 59,259,765 (GRCm39) missense possibly damaging 0.74
R7512:Oit3 UTSW 10 59,274,716 (GRCm39) missense probably damaging 1.00
R7866:Oit3 UTSW 10 59,259,852 (GRCm39) missense probably benign 0.03
R8312:Oit3 UTSW 10 59,274,632 (GRCm39) missense probably benign 0.01
R8321:Oit3 UTSW 10 59,263,982 (GRCm39) missense probably benign 0.00
R8919:Oit3 UTSW 10 59,277,468 (GRCm39) missense unknown
R9131:Oit3 UTSW 10 59,271,751 (GRCm39) missense probably benign 0.01
R9457:Oit3 UTSW 10 59,277,505 (GRCm39) start codon destroyed unknown
R9478:Oit3 UTSW 10 59,274,464 (GRCm39) missense probably damaging 0.99
R9502:Oit3 UTSW 10 59,264,173 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTATGCCAAAGTAGAGTGAGTCG -3'
(R):5'- TTGTAAGGGCCAGAGCTTG -3'

Sequencing Primer
(F):5'- CCAAAGTAGAGTGAGTCGCGAAG -3'
(R):5'- CCAGAGCTTGGGATTCACTG -3'
Posted On 2018-04-02