Incidental Mutation 'R6326:Trhde'
ID510423
Institutional Source Beutler Lab
Gene Symbol Trhde
Ensembl Gene ENSMUSG00000050663
Gene NameTRH-degrading enzyme
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.175) question?
Stock #R6326 (G1)
Quality Score225.009
Status Not validated
Chromosome10
Chromosomal Location114398823-114802307 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 114567224 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 498 (M498K)
Ref Sequence ENSEMBL: ENSMUSP00000057449 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061632]
Predicted Effect probably damaging
Transcript: ENSMUST00000061632
AA Change: M498K

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000057449
Gene: ENSMUSG00000050663
AA Change: M498K

DomainStartEndE-ValueType
transmembrane domain 40 62 N/A INTRINSIC
Pfam:Peptidase_M1 141 531 2.6e-141 PFAM
Pfam:ERAP1_C 679 1004 5.7e-65 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152702
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the peptidase M1 family. The encoded protein is an extracellular peptidase that specifically cleaves and inactivates the neuropeptide thyrotropin-releasing hormone.[provided by RefSeq, Dec 2008]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110032A03Rik T G 9: 50,764,757 N87T probably damaging Het
2810474O19Rik T A 6: 149,328,995 Y1180N probably damaging Het
Adamts17 A T 7: 67,120,888 Y915F probably benign Het
Adap2 T A 11: 80,155,022 F43I probably damaging Het
Adprhl2 A T 4: 126,316,613 L358Q possibly damaging Het
AI314180 T A 4: 58,827,068 T1022S probably benign Het
Akap9 A C 5: 3,962,061 Q921H probably damaging Het
Amigo2 A G 15: 97,245,375 S389P probably benign Het
Atg2b A T 12: 105,661,092 C545* probably null Het
C2cd3 A G 7: 100,416,428 E807G probably benign Het
Ccdc110 A G 8: 45,942,041 E323G probably damaging Het
Cdk5rap2 T A 4: 70,235,454 S1711C probably damaging Het
Cebpzos T G 17: 78,919,057 D39E probably damaging Het
Cenpe A G 3: 135,239,778 N1018D probably benign Het
Clspn C A 4: 126,565,739 H141Q probably damaging Het
Cluh C T 11: 74,666,242 A1010V probably benign Het
Col27a1 G T 4: 63,324,441 probably benign Het
Cpt2 T C 4: 107,914,316 M61V probably benign Het
Ddr2 T A 1: 169,987,140 H578L probably damaging Het
Dnah14 T A 1: 181,783,556 I3749N probably damaging Het
Dnajc18 T C 18: 35,680,925 T264A possibly damaging Het
Eml6 T C 11: 29,819,066 N693S probably damaging Het
Ephx4 A G 5: 107,406,111 E9G probably damaging Het
Eps15l1 G A 8: 72,341,434 Q747* probably null Het
Flrt1 C T 19: 7,096,609 S191N probably damaging Het
Gm5114 C T 7: 39,408,155 R680H probably benign Het
Gm5431 T C 11: 48,889,345 H250R probably damaging Het
Gm7233 T C 14: 43,182,885 C198R possibly damaging Het
Herc2 C G 7: 56,222,934 Q4407E probably damaging Het
Hmx3 C G 7: 131,543,005 probably benign Het
Hoxb7 C A 11: 96,287,083 A119E probably benign Het
Ifi207 A T 1: 173,729,966 M402K probably benign Het
Ints14 T C 9: 64,964,437 V19A probably benign Het
Itgae T A 11: 73,131,693 N911K possibly damaging Het
Kif1a T C 1: 93,076,326 S145G probably damaging Het
Klhdc4 A G 8: 121,805,054 W187R probably damaging Het
Krt1 A T 15: 101,850,249 I160N probably damaging Het
Krt12 T C 11: 99,416,919 T448A probably benign Het
Lcmt2 G A 2: 121,139,457 R382* probably null Het
Map3k8 C T 18: 4,340,651 S221N probably damaging Het
Med17 T C 9: 15,279,558 D79G probably benign Het
Mlf1 A T 3: 67,399,727 I257F probably damaging Het
Mov10l1 T A 15: 88,994,895 F153I probably damaging Het
Msto1 A C 3: 88,912,098 V149G probably damaging Het
Mybl1 T C 1: 9,678,507 probably null Het
Myoc A G 1: 162,649,011 Y428C probably damaging Het
Nin A G 12: 70,045,181 S785P possibly damaging Het
Oit3 A T 10: 59,428,239 F358I probably damaging Het
Olfr1095 C T 2: 86,850,994 V235I probably benign Het
Olfr794 A G 10: 129,570,702 T16A possibly damaging Het
Paip1 A G 13: 119,430,217 N29S probably benign Het
Pcdhgb4 T C 18: 37,722,456 S635P probably benign Het
Pcsk1 A G 13: 75,132,179 N708D possibly damaging Het
Plch1 C T 3: 63,781,390 W131* probably null Het
Prag1 A T 8: 36,102,706 M148L possibly damaging Het
Ptch1 A G 13: 63,543,545 L176P probably damaging Het
Ralgapa1 A T 12: 55,747,146 V568D probably damaging Het
Rb1 A T 14: 73,198,534 M897K probably benign Het
Robo3 T A 9: 37,427,027 Q386L probably damaging Het
Rtn4rl1 T C 11: 75,266,002 V420A possibly damaging Het
Sall1 A T 8: 89,030,268 N1069K probably benign Het
Sipa1l1 A G 12: 82,372,468 E640G probably damaging Het
Slc22a2 C A 17: 12,612,410 Y362* probably null Het
Slc5a9 T C 4: 111,880,253 E603G probably benign Het
Slc6a17 A T 3: 107,500,406 I83N probably damaging Het
Snx29 G T 16: 11,403,566 M285I probably benign Het
Spata2 T C 2: 167,484,174 T242A possibly damaging Het
Stard13 A G 5: 151,046,919 L733P possibly damaging Het
Svep1 A G 4: 58,073,045 V2088A possibly damaging Het
Tdp2 A G 13: 24,840,557 E279G probably damaging Het
Tnfrsf8 T G 4: 145,269,224 I422L probably damaging Het
Tpk1 T A 6: 43,346,802 T189S possibly damaging Het
Trim35 T A 14: 66,303,204 H168Q possibly damaging Het
Tubb5 T C 17: 35,836,455 probably benign Het
Vmn1r181 G A 7: 23,984,758 R216Q probably benign Het
Vmn2r77 G A 7: 86,801,823 G306R probably benign Het
Xkr4 C T 1: 3,671,038 R104H possibly damaging Het
Zcchc11 C T 4: 108,478,980 T6I probably benign Het
Zfp398 T C 6: 47,866,421 I337T possibly damaging Het
Other mutations in Trhde
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00323:Trhde APN 10 114486747 missense possibly damaging 0.77
IGL00516:Trhde APN 10 114446199 missense probably benign 0.01
IGL01371:Trhde APN 10 114588500 missense possibly damaging 0.57
IGL01488:Trhde APN 10 114446158 missense possibly damaging 0.58
IGL01602:Trhde APN 10 114787943 missense probably benign
IGL01605:Trhde APN 10 114787943 missense probably benign
IGL02150:Trhde APN 10 114592108 missense probably damaging 1.00
IGL02165:Trhde APN 10 114592161 missense probably damaging 1.00
IGL02340:Trhde APN 10 114592213 splice site probably benign
IGL02412:Trhde APN 10 114486925 missense probably damaging 1.00
IGL02421:Trhde APN 10 114412461 missense probably damaging 1.00
IGL02496:Trhde APN 10 114800561 nonsense probably null
IGL02952:Trhde APN 10 114800573 missense probably damaging 0.99
IGL03197:Trhde APN 10 114413308 missense probably benign 0.00
l3-37 UTSW 10 114801081 missense probably benign
R0360:Trhde UTSW 10 114502982 splice site probably benign
R0364:Trhde UTSW 10 114502982 splice site probably benign
R0457:Trhde UTSW 10 114448262 missense probably benign 0.37
R0589:Trhde UTSW 10 114448324 missense probably benign 0.01
R1132:Trhde UTSW 10 114412478 missense possibly damaging 0.86
R1288:Trhde UTSW 10 114801290 missense probably benign 0.37
R1569:Trhde UTSW 10 114446188 missense possibly damaging 0.78
R1776:Trhde UTSW 10 114800603 missense probably benign 0.06
R1781:Trhde UTSW 10 114588500 missense possibly damaging 0.57
R1927:Trhde UTSW 10 114800849 missense probably damaging 1.00
R1976:Trhde UTSW 10 114588431 missense possibly damaging 0.57
R2011:Trhde UTSW 10 114498793 missense probably benign 0.02
R2332:Trhde UTSW 10 114592165 missense probably damaging 1.00
R2356:Trhde UTSW 10 114401516 missense probably damaging 1.00
R3107:Trhde UTSW 10 114592066 missense probably damaging 1.00
R3108:Trhde UTSW 10 114592066 missense probably damaging 1.00
R3907:Trhde UTSW 10 114800696 missense possibly damaging 0.72
R4067:Trhde UTSW 10 114444680 nonsense probably null
R4214:Trhde UTSW 10 114788070 missense possibly damaging 0.51
R4428:Trhde UTSW 10 114503123 missense probably damaging 1.00
R4429:Trhde UTSW 10 114503123 missense probably damaging 1.00
R4430:Trhde UTSW 10 114503123 missense probably damaging 1.00
R5244:Trhde UTSW 10 114801081 missense probably benign
R5456:Trhde UTSW 10 114486760 missense possibly damaging 0.58
R5540:Trhde UTSW 10 114800592 missense probably benign 0.45
R5699:Trhde UTSW 10 114588502 missense probably benign 0.00
R5967:Trhde UTSW 10 114567134 missense probably damaging 1.00
R6467:Trhde UTSW 10 114504198 missense probably damaging 1.00
R7028:Trhde UTSW 10 114518177 missense probably damaging 1.00
R7264:Trhde UTSW 10 114800871 missense possibly damaging 0.93
R7266:Trhde UTSW 10 114800871 missense possibly damaging 0.93
R7310:Trhde UTSW 10 114800573 missense probably damaging 0.99
R7460:Trhde UTSW 10 114413263 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCAGGCCTATTCATAAGATGC -3'
(R):5'- TGAGGCTCACCGTGTAAGAC -3'

Sequencing Primer
(F):5'- ACAACCCATTTTCATTCACTAGAAAG -3'
(R):5'- CTCACCGTGTAAGACTGATGAGC -3'
Posted On2018-04-02