Mutagenetix > Incidental Mutation

Incidental Mutation 'R6326:Eml6'

510425

Institutional Source

Beutler Lab

Gene Symbol

Eml6

Ensembl Gene

ENSMUSG00000044072

Gene Name

echinoderm microtubule associated protein like 6

Synonyms

MMRRC Submission

044480-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.179) question?

Stock #

R6326 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

29743048-30026033 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 29819066 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Serine at position 693 (N693S)

Ref Sequence

ENSEMBL: ENSMUSP00000051080 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000058902] [ENSMUST00000104962]

AlphaFold

Q5SQM0

Predicted Effect

probably damaging
Transcript: ENSMUST00000058902
AA Change: N693S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000051080
Gene: ENSMUSG00000044072
AA Change: N693S

Domain	Start	End	E-Value	Type
low complexity region	36	47	N/A	INTRINSIC
WD40	49	91	1.79e-1	SMART
WD40	94	136	1.42e-4	SMART
WD40	139	178	5.31e-4	SMART
WD40	184	224	8.84e1	SMART
WD40	225	263	3.75e-4	SMART
WD40	313	353	4.69e-5	SMART
WD40	356	394	2.22e0	SMART
WD40	397	436	1.72e0	SMART
WD40	505	546	1.7e2	SMART
WD40	552	592	4.55e-3	SMART
low complexity region	613	625	N/A	INTRINSIC
Pfam:HELP	653	715	1.9e-22	PFAM
WD40	716	757	9.24e-1	SMART
WD40	760	802	6.53e-4	SMART
WD40	805	844	2.98e-1	SMART
WD40	856	891	8.52e1	SMART
WD40	892	929	2.09e-2	SMART
WD40	986	1026	1.18e-1	SMART
WD40	1032	1068	3.44e0	SMART
WD40	1071	1111	2.58e-1	SMART
WD40	1180	1221	9.24e-1	SMART
WD40	1227	1267	3.85e-1	SMART
low complexity region	1280	1291	N/A	INTRINSIC
Pfam:HELP	1329	1402	5e-15	PFAM
WD40	1404	1447	2.66e0	SMART
WD40	1450	1492	1.85e0	SMART
WD40	1495	1534	2.97e0	SMART
WD40	1543	1582	7.1e1	SMART
WD40	1584	1629	9.51e1	SMART
WD40	1675	1715	3.05e-4	SMART
WD40	1718	1758	8.84e1	SMART
WD40	1759	1798	7.16e-1	SMART
WD40	1869	1910	1.53e1	SMART
WD40	1916	1956	4.62e-4	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000104962

SMART Domains

Protein: ENSMUSP00000100568
Gene: ENSMUSG00000078157

Domain	Start	End	E-Value	Type
ANK	19	50	1.53e3	SMART
ANK	57	87	1.7e-3	SMART
ANK	99	128	3.6e-2	SMART
ANK	132	162	3.31e-1	SMART
ANK	166	195	8.19e-6	SMART
ANK	199	228	7.83e-3	SMART
ANK	231	260	1.8e-2	SMART
low complexity region	297	306	N/A	INTRINSIC
low complexity region	434	445	N/A	INTRINSIC
low complexity region	496	507	N/A	INTRINSIC
ANK	536	578	8.39e-3	SMART
ANK	582	611	3.91e-3	SMART

Predicted Effect

unknown
Transcript: ENSMUST00000109452
AA Change: I48V

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.5%
20x: 98.3%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 79 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1110032A03Rik	T	G	9: 50,764,757	N87T	probably damaging	Het
2810474O19Rik	T	A	6: 149,328,995	Y1180N	probably damaging	Het
Adamts17	A	T	7: 67,120,888	Y915F	probably benign	Het
Adap2	T	A	11: 80,155,022	F43I	probably damaging	Het
Adprhl2	A	T	4: 126,316,613	L358Q	possibly damaging	Het
AI314180	T	A	4: 58,827,068	T1022S	probably benign	Het
Akap9	A	C	5: 3,962,061	Q921H	probably damaging	Het
Amigo2	A	G	15: 97,245,375	S389P	probably benign	Het
Atg2b	A	T	12: 105,661,092	C545*	probably null	Het
C2cd3	A	G	7: 100,416,428	E807G	probably benign	Het
Ccdc110	A	G	8: 45,942,041	E323G	probably damaging	Het
Cdk5rap2	T	A	4: 70,235,454	S1711C	probably damaging	Het
Cebpzos	T	G	17: 78,919,057	D39E	probably damaging	Het
Cenpe	A	G	3: 135,239,778	N1018D	probably benign	Het
Clspn	C	A	4: 126,565,739	H141Q	probably damaging	Het
Cluh	C	T	11: 74,666,242	A1010V	probably benign	Het
Col27a1	G	T	4: 63,324,441		probably benign	Het
Cpt2	T	C	4: 107,914,316	M61V	probably benign	Het
Ddr2	T	A	1: 169,987,140	H578L	probably damaging	Het
Dnah14	T	A	1: 181,783,556	I3749N	probably damaging	Het
Dnajc18	T	C	18: 35,680,925	T264A	possibly damaging	Het
Ephx4	A	G	5: 107,406,111	E9G	probably damaging	Het
Eps15l1	G	A	8: 72,341,434	Q747*	probably null	Het
Flrt1	C	T	19: 7,096,609	S191N	probably damaging	Het
Gm5114	C	T	7: 39,408,155	R680H	probably benign	Het
Gm5431	T	C	11: 48,889,345	H250R	probably damaging	Het
Gm7233	T	C	14: 43,182,885	C198R	possibly damaging	Het
Herc2	C	G	7: 56,222,934	Q4407E	probably damaging	Het
Hmx3	C	G	7: 131,543,005		probably benign	Het
Hoxb7	C	A	11: 96,287,083	A119E	probably benign	Het
Ifi207	A	T	1: 173,729,966	M402K	probably benign	Het
Ints14	T	C	9: 64,964,437	V19A	probably benign	Het
Itgae	T	A	11: 73,131,693	N911K	possibly damaging	Het
Kif1a	T	C	1: 93,076,326	S145G	probably damaging	Het
Klhdc4	A	G	8: 121,805,054	W187R	probably damaging	Het
Krt1	A	T	15: 101,850,249	I160N	probably damaging	Het
Krt12	T	C	11: 99,416,919	T448A	probably benign	Het
Lcmt2	G	A	2: 121,139,457	R382*	probably null	Het
Map3k8	C	T	18: 4,340,651	S221N	probably damaging	Het
Med17	T	C	9: 15,279,558	D79G	probably benign	Het
Mlf1	A	T	3: 67,399,727	I257F	probably damaging	Het
Mov10l1	T	A	15: 88,994,895	F153I	probably damaging	Het
Msto1	A	C	3: 88,912,098	V149G	probably damaging	Het
Mybl1	T	C	1: 9,678,507		probably null	Het
Myoc	A	G	1: 162,649,011	Y428C	probably damaging	Het
Nin	A	G	12: 70,045,181	S785P	possibly damaging	Het
Oit3	A	T	10: 59,428,239	F358I	probably damaging	Het
Olfr1095	C	T	2: 86,850,994	V235I	probably benign	Het
Olfr794	A	G	10: 129,570,702	T16A	possibly damaging	Het
Paip1	A	G	13: 119,430,217	N29S	probably benign	Het
Pcdhgb4	T	C	18: 37,722,456	S635P	probably benign	Het
Pcsk1	A	G	13: 75,132,179	N708D	possibly damaging	Het
Plch1	C	T	3: 63,781,390	W131*	probably null	Het
Prag1	A	T	8: 36,102,706	M148L	possibly damaging	Het
Ptch1	A	G	13: 63,543,545	L176P	probably damaging	Het
Ralgapa1	A	T	12: 55,747,146	V568D	probably damaging	Het
Rb1	A	T	14: 73,198,534	M897K	probably benign	Het
Robo3	T	A	9: 37,427,027	Q386L	probably damaging	Het
Rtn4rl1	T	C	11: 75,266,002	V420A	possibly damaging	Het
Sall1	A	T	8: 89,030,268	N1069K	probably benign	Het
Sipa1l1	A	G	12: 82,372,468	E640G	probably damaging	Het
Slc22a2	C	A	17: 12,612,410	Y362*	probably null	Het
Slc5a9	T	C	4: 111,880,253	E603G	probably benign	Het
Slc6a17	A	T	3: 107,500,406	I83N	probably damaging	Het
Snx29	G	T	16: 11,403,566	M285I	probably benign	Het
Spata2	T	C	2: 167,484,174	T242A	possibly damaging	Het
Stard13	A	G	5: 151,046,919	L733P	possibly damaging	Het
Svep1	A	G	4: 58,073,045	V2088A	possibly damaging	Het
Tdp2	A	G	13: 24,840,557	E279G	probably damaging	Het
Tnfrsf8	T	G	4: 145,269,224	I422L	probably damaging	Het
Tpk1	T	A	6: 43,346,802	T189S	possibly damaging	Het
Trhde	A	T	10: 114,567,224	M498K	probably damaging	Het
Trim35	T	A	14: 66,303,204	H168Q	possibly damaging	Het
Tubb5	T	C	17: 35,836,455		probably benign	Het
Vmn1r181	G	A	7: 23,984,758	R216Q	probably benign	Het
Vmn2r77	G	A	7: 86,801,823	G306R	probably benign	Het
Xkr4	C	T	1: 3,671,038	R104H	possibly damaging	Het
Zcchc11	C	T	4: 108,478,980	T6I	probably benign	Het
Zfp398	T	C	6: 47,866,421	I337T	possibly damaging	Het

Other mutations in Eml6

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01071:Eml6	APN	11	29850816	critical splice donor site	probably null
IGL01407:Eml6	APN	11	29755021	nonsense	probably null
IGL01434:Eml6	APN	11	29819090	missense	probably damaging	1.00
IGL01578:Eml6	APN	11	29850870	missense	probably benign	0.02
IGL01780:Eml6	APN	11	29805175	missense	probably benign	0.17
IGL01821:Eml6	APN	11	29821699	missense	probably benign	0.00
IGL01837:Eml6	APN	11	29777055	missense	probably benign	0.00
IGL01904:Eml6	APN	11	29838613	nonsense	probably null
IGL01972:Eml6	APN	11	29838451	missense	possibly damaging	0.67
IGL02134:Eml6	APN	11	29759066	missense	probably benign	0.13
IGL02192:Eml6	APN	11	29805743	missense	probably benign	0.00
IGL02377:Eml6	APN	11	29777282	missense	probably damaging	0.98
IGL02584:Eml6	APN	11	29749387	missense	probably damaging	0.99
IGL02587:Eml6	APN	11	29784236	missense	possibly damaging	0.92
IGL02810:Eml6	APN	11	29849016	missense	possibly damaging	0.94
IGL02873:Eml6	APN	11	29880700	missense	probably benign	0.10
IGL02880:Eml6	APN	11	29749959	missense	probably benign	0.03
IGL03289:Eml6	APN	11	29795328	missense	possibly damaging	0.49
IGL03301:Eml6	APN	11	29764083	missense	probably benign	0.18
IGL03386:Eml6	APN	11	29749934	missense	probably benign
IGL03407:Eml6	APN	11	29906330	missense	probably damaging	1.00
PIT4453001:Eml6	UTSW	11	29802489	missense	probably damaging	1.00
R0125:Eml6	UTSW	11	29882088	missense	probably benign	0.19
R0240:Eml6	UTSW	11	29792367	missense	possibly damaging	0.84
R0240:Eml6	UTSW	11	29792367	missense	possibly damaging	0.84
R0271:Eml6	UTSW	11	29848949	missense	possibly damaging	0.48
R0304:Eml6	UTSW	11	29777441	missense	probably benign	0.00
R0415:Eml6	UTSW	11	29749392	missense	possibly damaging	0.84
R0449:Eml6	UTSW	11	29893213	missense	probably benign	0.01
R0538:Eml6	UTSW	11	29760010	splice site	probably benign
R0671:Eml6	UTSW	11	29805065	missense	probably benign	0.00
R0766:Eml6	UTSW	11	29831219	splice site	probably benign
R0800:Eml6	UTSW	11	29749877	missense	probably benign	0.08
R0841:Eml6	UTSW	11	29777430	missense	probably benign	0.41
R0879:Eml6	UTSW	11	29850816	critical splice donor site	probably null
R1061:Eml6	UTSW	11	29777267	missense	probably damaging	1.00
R1145:Eml6	UTSW	11	29777430	missense	probably benign	0.41
R1145:Eml6	UTSW	11	29777430	missense	probably benign	0.41
R1172:Eml6	UTSW	11	29749824	missense	possibly damaging	0.54
R1173:Eml6	UTSW	11	29749824	missense	possibly damaging	0.54
R1174:Eml6	UTSW	11	29749824	missense	possibly damaging	0.54
R1199:Eml6	UTSW	11	29755044	missense	possibly damaging	0.93
R1311:Eml6	UTSW	11	29831088	splice site	probably benign
R1312:Eml6	UTSW	11	29831219	splice site	probably benign
R1355:Eml6	UTSW	11	29833085	missense	probably benign	0.03
R1370:Eml6	UTSW	11	29833085	missense	probably benign	0.03
R1457:Eml6	UTSW	11	30024459	missense	probably damaging	1.00
R1486:Eml6	UTSW	11	29805114	missense	possibly damaging	0.83
R1511:Eml6	UTSW	11	29818374	missense	probably damaging	1.00
R1532:Eml6	UTSW	11	29792256	splice site	probably null
R1642:Eml6	UTSW	11	29777001	critical splice donor site	probably null
R1682:Eml6	UTSW	11	29759065	missense	probably benign	0.13
R1687:Eml6	UTSW	11	29833187	missense	probably damaging	1.00
R1699:Eml6	UTSW	11	29746282	nonsense	probably null
R1796:Eml6	UTSW	11	29881975	missense	probably benign	0.19
R1797:Eml6	UTSW	11	29882041	missense	probably benign	0.09
R1837:Eml6	UTSW	11	29749802	splice site	probably null
R1874:Eml6	UTSW	11	29831136	missense	probably damaging	0.99
R1967:Eml6	UTSW	11	30024545	missense	probably damaging	1.00
R1969:Eml6	UTSW	11	29833075	missense	probably benign
R2007:Eml6	UTSW	11	29848814	critical splice donor site	probably null
R2012:Eml6	UTSW	11	29831128	missense	possibly damaging	0.85
R2198:Eml6	UTSW	11	29850935	missense	probably benign	0.01
R2217:Eml6	UTSW	11	29818907	missense	probably damaging	1.00
R2218:Eml6	UTSW	11	29818907	missense	probably damaging	1.00
R2403:Eml6	UTSW	11	29802434	missense	probably benign	0.05
R2520:Eml6	UTSW	11	29791993	missense	probably damaging	1.00
R2937:Eml6	UTSW	11	29833049	splice site	probably benign
R2938:Eml6	UTSW	11	29833049	splice site	probably benign
R3085:Eml6	UTSW	11	29809332	missense	probably damaging	0.96
R3236:Eml6	UTSW	11	29831097	critical splice donor site	probably null
R3738:Eml6	UTSW	11	29803137	missense	probably benign	0.20
R3739:Eml6	UTSW	11	29803137	missense	probably benign	0.20
R3752:Eml6	UTSW	11	29809360	missense	probably benign	0.06
R3854:Eml6	UTSW	11	29749905	missense	possibly damaging	0.76
R3941:Eml6	UTSW	11	29803167	missense	probably damaging	0.98
R4034:Eml6	UTSW	11	29803137	missense	probably benign	0.20
R4049:Eml6	UTSW	11	29838577	missense	probably damaging	1.00
R4108:Eml6	UTSW	11	29805136	missense	probably damaging	0.98
R4657:Eml6	UTSW	11	29805108	missense	possibly damaging	0.77
R4662:Eml6	UTSW	11	29777390	missense	probably damaging	1.00
R4665:Eml6	UTSW	11	29819007	nonsense	probably null
R4721:Eml6	UTSW	11	29838525	missense	possibly damaging	0.95
R4729:Eml6	UTSW	11	29833204	missense	probably damaging	1.00
R4766:Eml6	UTSW	11	29805757	missense	probably benign	0.22
R4810:Eml6	UTSW	11	29755011	missense	possibly damaging	0.92
R4831:Eml6	UTSW	11	29777052	nonsense	probably null
R5035:Eml6	UTSW	11	29854187	missense	probably benign	0.00
R5064:Eml6	UTSW	11	29749300	missense	probably benign	0.12
R5103:Eml6	UTSW	11	29850905	missense	possibly damaging	0.65
R5121:Eml6	UTSW	11	29744606	missense	probably benign	0.03
R5161:Eml6	UTSW	11	30024467	missense	probably damaging	0.99
R5211:Eml6	UTSW	11	29854145	missense	probably benign	0.02
R5268:Eml6	UTSW	11	29803108	missense	probably benign	0.15
R5390:Eml6	UTSW	11	29760096	missense	probably damaging	1.00
R5529:Eml6	UTSW	11	29764126	missense	probably benign	0.04
R6239:Eml6	UTSW	11	29749275	missense	probably damaging	1.00
R6395:Eml6	UTSW	11	29809321	missense	probably benign	0.00
R6476:Eml6	UTSW	11	29791971	critical splice donor site	probably null
R6483:Eml6	UTSW	11	29749875	missense	probably benign	0.00
R6701:Eml6	UTSW	11	29785748	missense	probably damaging	0.98
R6753:Eml6	UTSW	11	29754987	missense	probably damaging	1.00
R6809:Eml6	UTSW	11	29803161	missense	probably benign	0.23
R6847:Eml6	UTSW	11	29818447	missense	probably benign	0.00
R6855:Eml6	UTSW	11	29751381	splice site	probably null
R7168:Eml6	UTSW	11	29838529	missense	probably benign	0.01
R7175:Eml6	UTSW	11	29784231	missense	probably benign	0.00
R7305:Eml6	UTSW	11	29777258	missense	probably benign	0.01
R7615:Eml6	UTSW	11	29802501	missense	possibly damaging	0.49
R7692:Eml6	UTSW	11	29753085	missense	probably damaging	0.98
R7980:Eml6	UTSW	11	29833205	missense	probably damaging	1.00
R8026:Eml6	UTSW	11	29749973	missense	possibly damaging	0.63
R8046:Eml6	UTSW	11	29758981	missense	probably damaging	0.99
R8049:Eml6	UTSW	11	29893201	missense	possibly damaging	0.95
R8114:Eml6	UTSW	11	29754910	missense	probably damaging	1.00
R8425:Eml6	UTSW	11	29755008	missense	probably benign	0.00
R8799:Eml6	UTSW	11	29758981	missense	probably benign	0.11
R8945:Eml6	UTSW	11	29753110	missense	probably damaging	0.98
R8977:Eml6	UTSW	11	29784182	missense	possibly damaging	0.59
R8986:Eml6	UTSW	11	29805181	missense	possibly damaging	0.92
R9088:Eml6	UTSW	11	29818424	missense	probably damaging	0.96
R9150:Eml6	UTSW	11	29805791	missense	probably benign	0.15
R9209:Eml6	UTSW	11	29831175	missense	probably damaging	1.00
R9288:Eml6	UTSW	11	29838641	critical splice acceptor site	probably null
R9467:Eml6	UTSW	11	29819076	missense	probably damaging	0.99
R9481:Eml6	UTSW	11	29838641	critical splice acceptor site	probably null
R9534:Eml6	UTSW	11	29784155	missense	possibly damaging	0.45
RF037:Eml6	UTSW	11	29752549	critical splice acceptor site	probably benign
RF039:Eml6	UTSW	11	29752551	critical splice acceptor site	probably benign

Predicted Primers

PCR Primer
(F):5'- ATTGAGGAGAGACACATACCTGTCC -3'
(R):5'- CTGAACAAGGATTGCTTTTGGC -3'

Sequencing Primer
(F):5'- ATACCTGTCCAGTGGCTACATAG -3'
(R):5'- AGTTGAAGGTCTGCAAGTAGATTC -3'

Posted On

2018-04-02