Incidental Mutation 'R6326:Ralgapa1'
ID 510433
Institutional Source Beutler Lab
Gene Symbol Ralgapa1
Ensembl Gene ENSMUSG00000021027
Gene Name Ral GTPase activating protein, alpha subunit 1
Synonyms Garnl1, 4930400K19Rik, Tulip1, 2310003F20Rik
MMRRC Submission 044480-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.802) question?
Stock # R6326 (G1)
Quality Score 225.009
Status Not validated
Chromosome 12
Chromosomal Location 55649681-55867952 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 55793931 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Aspartic acid at position 568 (V568D)
Ref Sequence ENSEMBL: ENSMUSP00000151498 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000085385] [ENSMUST00000110687] [ENSMUST00000219432] [ENSMUST00000220367] [ENSMUST00000226244]
AlphaFold Q6GYP7
Predicted Effect probably damaging
Transcript: ENSMUST00000085385
AA Change: V568D

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000082503
Gene: ENSMUSG00000021027
AA Change: V568D

DomainStartEndE-ValueType
low complexity region 644 651 N/A INTRINSIC
low complexity region 676 690 N/A INTRINSIC
low complexity region 692 704 N/A INTRINSIC
low complexity region 894 915 N/A INTRINSIC
low complexity region 1386 1395 N/A INTRINSIC
low complexity region 1784 1798 N/A INTRINSIC
Pfam:Rap_GAP 1824 2003 7.4e-66 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000110687
AA Change: V568D

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000106315
Gene: ENSMUSG00000021027
AA Change: V568D

DomainStartEndE-ValueType
low complexity region 644 651 N/A INTRINSIC
low complexity region 676 690 N/A INTRINSIC
low complexity region 692 704 N/A INTRINSIC
low complexity region 894 915 N/A INTRINSIC
low complexity region 1386 1395 N/A INTRINSIC
low complexity region 1784 1798 N/A INTRINSIC
Pfam:Rap_GAP 1824 2001 1.9e-48 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000219432
AA Change: V568D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219529
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219542
Predicted Effect probably damaging
Transcript: ENSMUST00000220367
AA Change: V568D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000226244
AA Change: V568D

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Meta Mutation Damage Score 0.4068 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a major subunit of the RAL-GTPase activating protein. A similar protein in mouse binds E12, a transcriptional regulator of immunoglobulin genes. The mouse protein also functions in skeletal muscle by binding to the regulatory 14-3-3 proteins upon stimulation with insulin or muscle contraction. A pseudogene of this gene has been identified on chromosome 9. [provided by RefSeq, Oct 2016]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts17 A T 7: 66,770,636 (GRCm39) Y915F probably benign Het
Adap2 T A 11: 80,045,848 (GRCm39) F43I probably damaging Het
Adprs A T 4: 126,210,406 (GRCm39) L358Q possibly damaging Het
Akap9 A C 5: 4,012,061 (GRCm39) Q921H probably damaging Het
Amigo2 A G 15: 97,143,256 (GRCm39) S389P probably benign Het
Atg2b A T 12: 105,627,351 (GRCm39) C545* probably null Het
C2cd3 A G 7: 100,065,635 (GRCm39) E807G probably benign Het
Ccdc110 A G 8: 46,395,078 (GRCm39) E323G probably damaging Het
Cdk5rap2 T A 4: 70,153,691 (GRCm39) S1711C probably damaging Het
Cebpzos T G 17: 79,226,486 (GRCm39) D39E probably damaging Het
Cenpe A G 3: 134,945,539 (GRCm39) N1018D probably benign Het
Cfap68 T G 9: 50,676,057 (GRCm39) N87T probably damaging Het
Clspn C A 4: 126,459,532 (GRCm39) H141Q probably damaging Het
Cluh C T 11: 74,557,068 (GRCm39) A1010V probably benign Het
Col27a1 G T 4: 63,242,678 (GRCm39) probably benign Het
Cpt2 T C 4: 107,771,513 (GRCm39) M61V probably benign Het
Ddr2 T A 1: 169,814,709 (GRCm39) H578L probably damaging Het
Dnah14 T A 1: 181,611,121 (GRCm39) I3749N probably damaging Het
Dnajc18 T C 18: 35,813,978 (GRCm39) T264A possibly damaging Het
Ecpas T A 4: 58,827,068 (GRCm39) T1022S probably benign Het
Eml6 T C 11: 29,769,066 (GRCm39) N693S probably damaging Het
Ephx4 A G 5: 107,553,977 (GRCm39) E9G probably damaging Het
Eps15l1 G A 8: 73,095,278 (GRCm39) Q747* probably null Het
Flrt1 C T 19: 7,073,974 (GRCm39) S191N probably damaging Het
Gm5114 C T 7: 39,057,579 (GRCm39) R680H probably benign Het
Gm5431 T C 11: 48,780,172 (GRCm39) H250R probably damaging Het
Gm7233 T C 14: 43,040,342 (GRCm39) C198R possibly damaging Het
Herc2 C G 7: 55,872,682 (GRCm39) Q4407E probably damaging Het
Hmx3 C G 7: 131,144,734 (GRCm39) probably benign Het
Hoxb7 C A 11: 96,177,909 (GRCm39) A119E probably benign Het
Ifi207 A T 1: 173,557,532 (GRCm39) M402K probably benign Het
Ints14 T C 9: 64,871,719 (GRCm39) V19A probably benign Het
Itgae T A 11: 73,022,519 (GRCm39) N911K possibly damaging Het
Kif1a T C 1: 93,004,048 (GRCm39) S145G probably damaging Het
Klhdc4 A G 8: 122,531,793 (GRCm39) W187R probably damaging Het
Krt1 A T 15: 101,758,684 (GRCm39) I160N probably damaging Het
Krt12 T C 11: 99,307,745 (GRCm39) T448A probably benign Het
Lcmt2 G A 2: 120,969,938 (GRCm39) R382* probably null Het
Map3k8 C T 18: 4,340,651 (GRCm39) S221N probably damaging Het
Med17 T C 9: 15,190,854 (GRCm39) D79G probably benign Het
Mlf1 A T 3: 67,307,060 (GRCm39) I257F probably damaging Het
Mov10l1 T A 15: 88,879,098 (GRCm39) F153I probably damaging Het
Msto1 A C 3: 88,819,405 (GRCm39) V149G probably damaging Het
Mybl1 T C 1: 9,748,732 (GRCm39) probably null Het
Myoc A G 1: 162,476,580 (GRCm39) Y428C probably damaging Het
Nin A G 12: 70,091,955 (GRCm39) S785P possibly damaging Het
Oit3 A T 10: 59,264,061 (GRCm39) F358I probably damaging Het
Or5t15 C T 2: 86,681,338 (GRCm39) V235I probably benign Het
Or6c88 A G 10: 129,406,571 (GRCm39) T16A possibly damaging Het
Paip1 A G 13: 119,566,753 (GRCm39) N29S probably benign Het
Pcdhgb4 T C 18: 37,855,509 (GRCm39) S635P probably benign Het
Pcsk1 A G 13: 75,280,298 (GRCm39) N708D possibly damaging Het
Plch1 C T 3: 63,688,811 (GRCm39) W131* probably null Het
Prag1 A T 8: 36,569,860 (GRCm39) M148L possibly damaging Het
Ptch1 A G 13: 63,691,359 (GRCm39) L176P probably damaging Het
Rb1 A T 14: 73,435,974 (GRCm39) M897K probably benign Het
Resf1 T A 6: 149,230,493 (GRCm39) Y1180N probably damaging Het
Robo3 T A 9: 37,338,323 (GRCm39) Q386L probably damaging Het
Rtn4rl1 T C 11: 75,156,828 (GRCm39) V420A possibly damaging Het
Sall1 A T 8: 89,756,896 (GRCm39) N1069K probably benign Het
Sipa1l1 A G 12: 82,419,242 (GRCm39) E640G probably damaging Het
Slc22a2 C A 17: 12,831,297 (GRCm39) Y362* probably null Het
Slc5a9 T C 4: 111,737,450 (GRCm39) E603G probably benign Het
Slc6a17 A T 3: 107,407,722 (GRCm39) I83N probably damaging Het
Snx29 G T 16: 11,221,430 (GRCm39) M285I probably benign Het
Spata2 T C 2: 167,326,094 (GRCm39) T242A possibly damaging Het
Stard13 A G 5: 150,970,384 (GRCm39) L733P possibly damaging Het
Svep1 A G 4: 58,073,045 (GRCm39) V2088A possibly damaging Het
Tdp2 A G 13: 25,024,540 (GRCm39) E279G probably damaging Het
Tnfrsf8 T G 4: 144,995,794 (GRCm39) I422L probably damaging Het
Tpk1 T A 6: 43,323,736 (GRCm39) T189S possibly damaging Het
Trhde A T 10: 114,403,129 (GRCm39) M498K probably damaging Het
Trim35 T A 14: 66,540,653 (GRCm39) H168Q possibly damaging Het
Tubb5 T C 17: 36,147,347 (GRCm39) probably benign Het
Tut4 C T 4: 108,336,177 (GRCm39) T6I probably benign Het
Vmn1r181 G A 7: 23,684,183 (GRCm39) R216Q probably benign Het
Vmn2r77 G A 7: 86,451,031 (GRCm39) G306R probably benign Het
Xkr4 C T 1: 3,741,261 (GRCm39) R104H possibly damaging Het
Zfp398 T C 6: 47,843,355 (GRCm39) I337T possibly damaging Het
Other mutations in Ralgapa1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00089:Ralgapa1 APN 12 55,769,558 (GRCm39) missense probably damaging 0.98
IGL00494:Ralgapa1 APN 12 55,793,970 (GRCm39) missense probably damaging 1.00
IGL00731:Ralgapa1 APN 12 55,749,237 (GRCm39) missense possibly damaging 0.94
IGL00851:Ralgapa1 APN 12 55,756,360 (GRCm39) missense possibly damaging 0.93
IGL01133:Ralgapa1 APN 12 55,689,144 (GRCm39) missense probably damaging 0.99
IGL01133:Ralgapa1 APN 12 55,689,133 (GRCm39) missense probably damaging 1.00
IGL01354:Ralgapa1 APN 12 55,824,101 (GRCm39) missense possibly damaging 0.68
IGL01514:Ralgapa1 APN 12 55,766,442 (GRCm39) missense probably damaging 0.97
IGL02033:Ralgapa1 APN 12 55,689,262 (GRCm39) missense possibly damaging 0.69
IGL02064:Ralgapa1 APN 12 55,754,862 (GRCm39) missense probably damaging 1.00
IGL02556:Ralgapa1 APN 12 55,689,234 (GRCm39) missense possibly damaging 0.80
IGL02605:Ralgapa1 APN 12 55,759,450 (GRCm39) missense possibly damaging 0.90
IGL02657:Ralgapa1 APN 12 55,720,292 (GRCm39) missense probably damaging 1.00
IGL02676:Ralgapa1 APN 12 55,723,202 (GRCm39) missense probably damaging 1.00
IGL02894:Ralgapa1 APN 12 55,763,854 (GRCm39) missense possibly damaging 0.79
IGL02944:Ralgapa1 APN 12 55,804,736 (GRCm39) missense probably benign 0.01
Anhydrous UTSW 12 55,842,563 (GRCm39) critical splice acceptor site probably null
Aqueous UTSW 12 55,745,639 (GRCm39) missense probably damaging 1.00
bantam UTSW 12 55,769,558 (GRCm39) critical splice donor site probably null
Deliquescent UTSW 12 55,829,685 (GRCm39) splice site probably benign
wickedwarlock UTSW 12 55,824,077 (GRCm39) missense probably null 0.99
F5770:Ralgapa1 UTSW 12 55,842,438 (GRCm39) splice site probably benign
IGL03046:Ralgapa1 UTSW 12 55,741,942 (GRCm39) missense probably damaging 1.00
R0011:Ralgapa1 UTSW 12 55,833,048 (GRCm39) missense probably damaging 0.99
R0096:Ralgapa1 UTSW 12 55,786,290 (GRCm39) missense probably damaging 1.00
R0277:Ralgapa1 UTSW 12 55,724,023 (GRCm39) missense probably damaging 0.99
R0323:Ralgapa1 UTSW 12 55,724,023 (GRCm39) missense probably damaging 0.99
R0333:Ralgapa1 UTSW 12 55,829,685 (GRCm39) splice site probably benign
R0361:Ralgapa1 UTSW 12 55,723,354 (GRCm39) missense possibly damaging 0.93
R0385:Ralgapa1 UTSW 12 55,723,823 (GRCm39) missense probably damaging 1.00
R0386:Ralgapa1 UTSW 12 55,754,852 (GRCm39) missense probably benign 0.03
R0498:Ralgapa1 UTSW 12 55,736,576 (GRCm39) missense possibly damaging 0.66
R0552:Ralgapa1 UTSW 12 55,723,550 (GRCm39) missense probably benign 0.27
R0564:Ralgapa1 UTSW 12 55,829,670 (GRCm39) missense possibly damaging 0.84
R0611:Ralgapa1 UTSW 12 55,842,483 (GRCm39) missense probably damaging 0.99
R0730:Ralgapa1 UTSW 12 55,712,448 (GRCm39) missense probably damaging 1.00
R0741:Ralgapa1 UTSW 12 55,723,366 (GRCm39) missense probably damaging 0.99
R0815:Ralgapa1 UTSW 12 55,809,466 (GRCm39) nonsense probably null
R0815:Ralgapa1 UTSW 12 55,829,562 (GRCm39) splice site probably benign
R0863:Ralgapa1 UTSW 12 55,809,466 (GRCm39) nonsense probably null
R0863:Ralgapa1 UTSW 12 55,829,562 (GRCm39) splice site probably benign
R1068:Ralgapa1 UTSW 12 55,837,095 (GRCm39) critical splice donor site probably null
R1147:Ralgapa1 UTSW 12 55,749,265 (GRCm39) missense probably damaging 1.00
R1147:Ralgapa1 UTSW 12 55,749,265 (GRCm39) missense probably damaging 1.00
R1256:Ralgapa1 UTSW 12 55,809,446 (GRCm39) missense possibly damaging 0.94
R1343:Ralgapa1 UTSW 12 55,754,763 (GRCm39) missense probably damaging 1.00
R1378:Ralgapa1 UTSW 12 55,723,711 (GRCm39) missense probably damaging 1.00
R1474:Ralgapa1 UTSW 12 55,788,265 (GRCm39) missense probably benign 0.09
R1494:Ralgapa1 UTSW 12 55,731,309 (GRCm39) missense probably damaging 0.99
R1593:Ralgapa1 UTSW 12 55,817,488 (GRCm39) missense probably damaging 1.00
R1607:Ralgapa1 UTSW 12 55,788,321 (GRCm39) missense probably damaging 1.00
R1681:Ralgapa1 UTSW 12 55,809,388 (GRCm39) missense probably benign 0.35
R1689:Ralgapa1 UTSW 12 55,723,552 (GRCm39) missense possibly damaging 0.79
R1714:Ralgapa1 UTSW 12 55,689,174 (GRCm39) missense probably damaging 1.00
R1832:Ralgapa1 UTSW 12 55,804,752 (GRCm39) missense probably benign 0.03
R1870:Ralgapa1 UTSW 12 55,723,817 (GRCm39) missense possibly damaging 0.66
R2040:Ralgapa1 UTSW 12 55,833,107 (GRCm39) missense probably damaging 1.00
R2043:Ralgapa1 UTSW 12 55,723,811 (GRCm39) missense probably damaging 0.99
R2046:Ralgapa1 UTSW 12 55,741,945 (GRCm39) missense probably damaging 1.00
R2109:Ralgapa1 UTSW 12 55,822,973 (GRCm39) missense possibly damaging 0.90
R2114:Ralgapa1 UTSW 12 55,833,134 (GRCm39) critical splice acceptor site probably null
R2115:Ralgapa1 UTSW 12 55,833,134 (GRCm39) critical splice acceptor site probably null
R2202:Ralgapa1 UTSW 12 55,659,585 (GRCm39) splice site probably null
R2203:Ralgapa1 UTSW 12 55,659,585 (GRCm39) splice site probably null
R2233:Ralgapa1 UTSW 12 55,763,856 (GRCm39) missense probably benign 0.13
R2235:Ralgapa1 UTSW 12 55,763,856 (GRCm39) missense probably benign 0.13
R2341:Ralgapa1 UTSW 12 55,723,909 (GRCm39) missense possibly damaging 0.66
R2507:Ralgapa1 UTSW 12 55,764,986 (GRCm39) missense probably damaging 1.00
R2508:Ralgapa1 UTSW 12 55,764,986 (GRCm39) missense probably damaging 1.00
R2972:Ralgapa1 UTSW 12 55,867,540 (GRCm39) missense possibly damaging 0.61
R3160:Ralgapa1 UTSW 12 55,756,371 (GRCm39) missense probably damaging 1.00
R3162:Ralgapa1 UTSW 12 55,756,371 (GRCm39) missense probably damaging 1.00
R3401:Ralgapa1 UTSW 12 55,705,922 (GRCm39) missense possibly damaging 0.66
R3416:Ralgapa1 UTSW 12 55,817,398 (GRCm39) splice site probably benign
R3499:Ralgapa1 UTSW 12 55,741,928 (GRCm39) splice site probably benign
R3799:Ralgapa1 UTSW 12 55,705,915 (GRCm39) missense probably damaging 1.00
R3948:Ralgapa1 UTSW 12 55,745,552 (GRCm39) missense probably damaging 1.00
R4039:Ralgapa1 UTSW 12 55,842,486 (GRCm39) missense probably damaging 0.99
R4120:Ralgapa1 UTSW 12 55,687,429 (GRCm39) missense probably damaging 1.00
R4165:Ralgapa1 UTSW 12 55,687,429 (GRCm39) missense probably damaging 1.00
R4166:Ralgapa1 UTSW 12 55,687,429 (GRCm39) missense probably damaging 1.00
R4212:Ralgapa1 UTSW 12 55,786,115 (GRCm39) critical splice donor site probably null
R4232:Ralgapa1 UTSW 12 55,687,429 (GRCm39) missense probably damaging 1.00
R4233:Ralgapa1 UTSW 12 55,687,429 (GRCm39) missense probably damaging 1.00
R4234:Ralgapa1 UTSW 12 55,687,429 (GRCm39) missense probably damaging 1.00
R4235:Ralgapa1 UTSW 12 55,687,429 (GRCm39) missense probably damaging 1.00
R4399:Ralgapa1 UTSW 12 55,842,563 (GRCm39) critical splice acceptor site probably null
R4698:Ralgapa1 UTSW 12 55,724,061 (GRCm39) splice site probably null
R4715:Ralgapa1 UTSW 12 55,740,243 (GRCm39) missense probably damaging 1.00
R4755:Ralgapa1 UTSW 12 55,759,533 (GRCm39) missense probably damaging 1.00
R4810:Ralgapa1 UTSW 12 55,841,778 (GRCm39) critical splice donor site probably null
R4827:Ralgapa1 UTSW 12 55,723,222 (GRCm39) missense probably damaging 1.00
R4849:Ralgapa1 UTSW 12 55,745,588 (GRCm39) missense probably damaging 0.99
R4934:Ralgapa1 UTSW 12 55,809,359 (GRCm39) missense possibly damaging 0.94
R5006:Ralgapa1 UTSW 12 55,764,899 (GRCm39) missense probably benign 0.02
R5114:Ralgapa1 UTSW 12 55,659,508 (GRCm39) missense possibly damaging 0.84
R5140:Ralgapa1 UTSW 12 55,712,459 (GRCm39) missense probably damaging 1.00
R5140:Ralgapa1 UTSW 12 55,822,937 (GRCm39) missense probably damaging 1.00
R5168:Ralgapa1 UTSW 12 55,804,817 (GRCm39) missense probably benign 0.05
R5407:Ralgapa1 UTSW 12 55,723,582 (GRCm39) missense possibly damaging 0.93
R5441:Ralgapa1 UTSW 12 55,766,408 (GRCm39) missense probably damaging 1.00
R5473:Ralgapa1 UTSW 12 55,723,495 (GRCm39) missense probably benign 0.41
R5624:Ralgapa1 UTSW 12 55,659,523 (GRCm39) missense probably damaging 1.00
R5766:Ralgapa1 UTSW 12 55,867,551 (GRCm39) start codon destroyed probably null 0.99
R5826:Ralgapa1 UTSW 12 55,723,898 (GRCm39) missense probably damaging 1.00
R5950:Ralgapa1 UTSW 12 55,785,050 (GRCm39) missense possibly damaging 0.58
R5980:Ralgapa1 UTSW 12 55,817,401 (GRCm39) splice site probably null
R6019:Ralgapa1 UTSW 12 55,730,827 (GRCm39) missense possibly damaging 0.92
R6065:Ralgapa1 UTSW 12 55,804,709 (GRCm39) critical splice donor site probably null
R6355:Ralgapa1 UTSW 12 55,745,639 (GRCm39) missense probably damaging 1.00
R6408:Ralgapa1 UTSW 12 55,730,695 (GRCm39) nonsense probably null
R6448:Ralgapa1 UTSW 12 55,766,446 (GRCm39) missense probably benign 0.14
R6453:Ralgapa1 UTSW 12 55,785,104 (GRCm39) missense probably damaging 1.00
R6590:Ralgapa1 UTSW 12 55,769,558 (GRCm39) critical splice donor site probably null
R6690:Ralgapa1 UTSW 12 55,769,558 (GRCm39) critical splice donor site probably null
R6738:Ralgapa1 UTSW 12 55,809,512 (GRCm39) missense probably damaging 1.00
R6836:Ralgapa1 UTSW 12 55,651,058 (GRCm39) splice site probably null
R6936:Ralgapa1 UTSW 12 55,832,997 (GRCm39) missense probably damaging 0.99
R6945:Ralgapa1 UTSW 12 55,822,976 (GRCm39) missense possibly damaging 0.64
R7028:Ralgapa1 UTSW 12 55,804,844 (GRCm39) missense probably damaging 1.00
R7075:Ralgapa1 UTSW 12 55,867,508 (GRCm39) missense possibly damaging 0.66
R7076:Ralgapa1 UTSW 12 55,768,361 (GRCm39) missense possibly damaging 0.82
R7098:Ralgapa1 UTSW 12 55,837,095 (GRCm39) critical splice donor site probably null
R7231:Ralgapa1 UTSW 12 55,650,976 (GRCm39) missense probably damaging 1.00
R7254:Ralgapa1 UTSW 12 55,741,978 (GRCm39) missense probably damaging 1.00
R7326:Ralgapa1 UTSW 12 55,755,789 (GRCm39) missense probably damaging 1.00
R7485:Ralgapa1 UTSW 12 55,759,457 (GRCm39) missense probably damaging 1.00
R7580:Ralgapa1 UTSW 12 55,765,013 (GRCm39) missense probably benign 0.00
R7677:Ralgapa1 UTSW 12 55,705,928 (GRCm39) missense probably damaging 0.96
R7702:Ralgapa1 UTSW 12 55,756,341 (GRCm39) missense probably damaging 1.00
R7702:Ralgapa1 UTSW 12 55,756,340 (GRCm39) missense probably damaging 1.00
R7707:Ralgapa1 UTSW 12 55,824,077 (GRCm39) missense probably null 0.99
R7723:Ralgapa1 UTSW 12 55,788,298 (GRCm39) missense probably benign
R7763:Ralgapa1 UTSW 12 55,804,740 (GRCm39) missense probably benign 0.28
R7791:Ralgapa1 UTSW 12 55,788,304 (GRCm39) missense probably damaging 0.97
R7812:Ralgapa1 UTSW 12 55,766,413 (GRCm39) missense possibly damaging 0.67
R7868:Ralgapa1 UTSW 12 55,659,423 (GRCm39) missense probably benign 0.00
R7895:Ralgapa1 UTSW 12 55,793,934 (GRCm39) missense probably benign 0.44
R7896:Ralgapa1 UTSW 12 55,744,663 (GRCm39) missense probably benign 0.01
R8004:Ralgapa1 UTSW 12 55,749,242 (GRCm39) missense probably damaging 0.99
R8094:Ralgapa1 UTSW 12 55,829,631 (GRCm39) missense probably damaging 0.99
R8213:Ralgapa1 UTSW 12 55,769,699 (GRCm39) missense probably damaging 0.99
R8307:Ralgapa1 UTSW 12 55,788,308 (GRCm39) missense probably damaging 0.99
R8423:Ralgapa1 UTSW 12 55,705,847 (GRCm39) missense probably damaging 0.99
R8462:Ralgapa1 UTSW 12 55,723,303 (GRCm39) missense possibly damaging 0.90
R8469:Ralgapa1 UTSW 12 55,786,198 (GRCm39) missense probably damaging 1.00
R8675:Ralgapa1 UTSW 12 55,785,002 (GRCm39) missense possibly damaging 0.93
R8802:Ralgapa1 UTSW 12 55,785,101 (GRCm39) missense probably damaging 0.99
R8937:Ralgapa1 UTSW 12 55,749,345 (GRCm39) missense probably damaging 0.96
R8953:Ralgapa1 UTSW 12 55,867,546 (GRCm39) missense probably damaging 0.99
R8974:Ralgapa1 UTSW 12 55,723,791 (GRCm39) missense probably benign
R9011:Ralgapa1 UTSW 12 55,652,314 (GRCm39) intron probably benign
R9089:Ralgapa1 UTSW 12 55,723,351 (GRCm39) missense probably damaging 0.97
R9124:Ralgapa1 UTSW 12 55,781,881 (GRCm39) missense probably damaging 1.00
R9254:Ralgapa1 UTSW 12 55,769,583 (GRCm39) missense probably damaging 1.00
R9320:Ralgapa1 UTSW 12 55,755,843 (GRCm39) missense possibly damaging 0.59
R9379:Ralgapa1 UTSW 12 55,769,583 (GRCm39) missense probably damaging 1.00
R9446:Ralgapa1 UTSW 12 55,754,808 (GRCm39) missense probably damaging 0.97
R9684:Ralgapa1 UTSW 12 55,659,485 (GRCm39) missense possibly damaging 0.63
Z1176:Ralgapa1 UTSW 12 55,755,865 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAGACAGTCTACTATAAGCATGATTAC -3'
(R):5'- AAATTTACACTTGATCACCCAGTG -3'

Sequencing Primer
(F):5'- GCAGCACTCTAACACTGT -3'
(R):5'- CTTACAGTCCTAGCACTTGAGAGG -3'
Posted On 2018-04-02