Mutagenetix > Incidental Mutations

Incidental Mutation 'R6326:Nin'

510434

Institutional Source

Beutler Lab

Gene Symbol

Nin

Ensembl Gene

ENSMUSG00000021068

Gene Name

ninein

Synonyms

3110068G20Rik

MMRRC Submission

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R6326 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

70011435-70113717 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 70045181 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Proline at position 785 (S785P)

Ref Sequence

ENSEMBL: ENSMUSP00000152240 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000021468] [ENSMUST00000085314] [ENSMUST00000095666] [ENSMUST00000169074] [ENSMUST00000220689] [ENSMUST00000222237] [ENSMUST00000222835] [ENSMUST00000223257]

AlphaFold

Q61043

Predicted Effect

possibly damaging
Transcript: ENSMUST00000021468
AA Change: S785P

PolyPhen 2 Score 0.909 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000021468
Gene: ENSMUSG00000021068
AA Change: S785P

Domain	Start	End	E-Value	Type
internal_repeat_1	7	67	7.83e-8	PROSPERO
low complexity region	97	108	N/A	INTRINSIC
low complexity region	115	132	N/A	INTRINSIC
internal_repeat_1	181	242	7.83e-8	PROSPERO
low complexity region	276	289	N/A	INTRINSIC
low complexity region	336	353	N/A	INTRINSIC
coiled coil region	358	570	N/A	INTRINSIC
coiled coil region	625	802	N/A	INTRINSIC
coiled coil region	834	926	N/A	INTRINSIC
coiled coil region	957	1008	N/A	INTRINSIC
low complexity region	1035	1044	N/A	INTRINSIC
low complexity region	1047	1057	N/A	INTRINSIC
coiled coil region	1069	1094	N/A	INTRINSIC
coiled coil region	1178	1325	N/A	INTRINSIC
low complexity region	1374	1385	N/A	INTRINSIC
coiled coil region	1425	1806	N/A	INTRINSIC
coiled coil region	1980	2013	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000085314
AA Change: S785P

PolyPhen 2 Score 0.953 (Sensitivity: 0.79; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000082422
Gene: ENSMUSG00000021068
AA Change: S785P

Domain	Start	End	E-Value	Type
internal_repeat_1	7	67	4.15e-8	PROSPERO
low complexity region	97	108	N/A	INTRINSIC
low complexity region	115	132	N/A	INTRINSIC
internal_repeat_1	181	242	4.15e-8	PROSPERO
low complexity region	276	289	N/A	INTRINSIC
low complexity region	336	353	N/A	INTRINSIC
coiled coil region	358	570	N/A	INTRINSIC
coiled coil region	625	802	N/A	INTRINSIC
coiled coil region	834	926	N/A	INTRINSIC
coiled coil region	957	1008	N/A	INTRINSIC
low complexity region	1035	1044	N/A	INTRINSIC
low complexity region	1047	1057	N/A	INTRINSIC
coiled coil region	1069	1094	N/A	INTRINSIC
coiled coil region	1178	1325	N/A	INTRINSIC
low complexity region	1374	1385	N/A	INTRINSIC
coiled coil region	1425	1806	N/A	INTRINSIC
coiled coil region	1971	2045	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000095666
AA Change: S785P

PolyPhen 2 Score 0.909 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000093327
Gene: ENSMUSG00000021068
AA Change: S785P

Domain	Start	End	E-Value	Type
internal_repeat_1	7	67	7.83e-8	PROSPERO
low complexity region	97	108	N/A	INTRINSIC
low complexity region	115	132	N/A	INTRINSIC
internal_repeat_1	181	242	7.83e-8	PROSPERO
low complexity region	276	289	N/A	INTRINSIC
low complexity region	336	353	N/A	INTRINSIC
coiled coil region	358	570	N/A	INTRINSIC
coiled coil region	625	802	N/A	INTRINSIC
coiled coil region	834	926	N/A	INTRINSIC
coiled coil region	957	1008	N/A	INTRINSIC
low complexity region	1035	1044	N/A	INTRINSIC
low complexity region	1047	1057	N/A	INTRINSIC
coiled coil region	1069	1094	N/A	INTRINSIC
coiled coil region	1178	1325	N/A	INTRINSIC
low complexity region	1374	1385	N/A	INTRINSIC
coiled coil region	1425	1806	N/A	INTRINSIC
coiled coil region	1980	2013	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000169074
AA Change: S785P

PolyPhen 2 Score 0.909 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000129648
Gene: ENSMUSG00000021068
AA Change: S785P

Domain	Start	End	E-Value	Type
internal_repeat_1	7	67	7.83e-8	PROSPERO
low complexity region	97	108	N/A	INTRINSIC
low complexity region	115	132	N/A	INTRINSIC
internal_repeat_1	181	242	7.83e-8	PROSPERO
low complexity region	276	289	N/A	INTRINSIC
low complexity region	336	353	N/A	INTRINSIC
coiled coil region	358	570	N/A	INTRINSIC
coiled coil region	625	802	N/A	INTRINSIC
coiled coil region	834	926	N/A	INTRINSIC
coiled coil region	957	1008	N/A	INTRINSIC
low complexity region	1035	1044	N/A	INTRINSIC
low complexity region	1047	1057	N/A	INTRINSIC
coiled coil region	1069	1094	N/A	INTRINSIC
coiled coil region	1178	1325	N/A	INTRINSIC
low complexity region	1374	1385	N/A	INTRINSIC
coiled coil region	1425	1806	N/A	INTRINSIC
coiled coil region	1980	2013	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000220689
AA Change: S785P

PolyPhen 2 Score 0.017 (Sensitivity: 0.95; Specificity: 0.80)

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000221486

Predicted Effect

possibly damaging
Transcript: ENSMUST00000222237
AA Change: S785P

PolyPhen 2 Score 0.953 (Sensitivity: 0.79; Specificity: 0.95)

Predicted Effect

probably benign
Transcript: ENSMUST00000222835
AA Change: S785P

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)

Predicted Effect

possibly damaging
Transcript: ENSMUST00000223257
AA Change: S785P

PolyPhen 2 Score 0.921 (Sensitivity: 0.81; Specificity: 0.94)

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000223316

Meta Mutation Damage Score

0.1795

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.5%
20x: 98.3%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of the proteins important for centrosomal function. This protein is important for positioning and anchoring the microtubules minus-ends in epithelial cells. Localization of this protein to the centrosome requires three leucine zippers in the central coiled-coil domain. Multiple alternatively spliced transcript variants that encode different isoforms have been reported. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 79 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1110032A03Rik	T	G	9: 50,764,757	N87T	probably damaging	Het
2810474O19Rik	T	A	6: 149,328,995	Y1180N	probably damaging	Het
Adamts17	A	T	7: 67,120,888	Y915F	probably benign	Het
Adap2	T	A	11: 80,155,022	F43I	probably damaging	Het
Adprhl2	A	T	4: 126,316,613	L358Q	possibly damaging	Het
AI314180	T	A	4: 58,827,068	T1022S	probably benign	Het
Akap9	A	C	5: 3,962,061	Q921H	probably damaging	Het
Amigo2	A	G	15: 97,245,375	S389P	probably benign	Het
Atg2b	A	T	12: 105,661,092	C545*	probably null	Het
C2cd3	A	G	7: 100,416,428	E807G	probably benign	Het
Ccdc110	A	G	8: 45,942,041	E323G	probably damaging	Het
Cdk5rap2	T	A	4: 70,235,454	S1711C	probably damaging	Het
Cebpzos	T	G	17: 78,919,057	D39E	probably damaging	Het
Cenpe	A	G	3: 135,239,778	N1018D	probably benign	Het
Clspn	C	A	4: 126,565,739	H141Q	probably damaging	Het
Cluh	C	T	11: 74,666,242	A1010V	probably benign	Het
Col27a1	G	T	4: 63,324,441		probably benign	Het
Cpt2	T	C	4: 107,914,316	M61V	probably benign	Het
Ddr2	T	A	1: 169,987,140	H578L	probably damaging	Het
Dnah14	T	A	1: 181,783,556	I3749N	probably damaging	Het
Dnajc18	T	C	18: 35,680,925	T264A	possibly damaging	Het
Eml6	T	C	11: 29,819,066	N693S	probably damaging	Het
Ephx4	A	G	5: 107,406,111	E9G	probably damaging	Het
Eps15l1	G	A	8: 72,341,434	Q747*	probably null	Het
Flrt1	C	T	19: 7,096,609	S191N	probably damaging	Het
Gm5114	C	T	7: 39,408,155	R680H	probably benign	Het
Gm5431	T	C	11: 48,889,345	H250R	probably damaging	Het
Gm7233	T	C	14: 43,182,885	C198R	possibly damaging	Het
Herc2	C	G	7: 56,222,934	Q4407E	probably damaging	Het
Hmx3	C	G	7: 131,543,005		probably benign	Het
Hoxb7	C	A	11: 96,287,083	A119E	probably benign	Het
Ifi207	A	T	1: 173,729,966	M402K	probably benign	Het
Ints14	T	C	9: 64,964,437	V19A	probably benign	Het
Itgae	T	A	11: 73,131,693	N911K	possibly damaging	Het
Kif1a	T	C	1: 93,076,326	S145G	probably damaging	Het
Klhdc4	A	G	8: 121,805,054	W187R	probably damaging	Het
Krt1	A	T	15: 101,850,249	I160N	probably damaging	Het
Krt12	T	C	11: 99,416,919	T448A	probably benign	Het
Lcmt2	G	A	2: 121,139,457	R382*	probably null	Het
Map3k8	C	T	18: 4,340,651	S221N	probably damaging	Het
Med17	T	C	9: 15,279,558	D79G	probably benign	Het
Mlf1	A	T	3: 67,399,727	I257F	probably damaging	Het
Mov10l1	T	A	15: 88,994,895	F153I	probably damaging	Het
Msto1	A	C	3: 88,912,098	V149G	probably damaging	Het
Mybl1	T	C	1: 9,678,507		probably null	Het
Myoc	A	G	1: 162,649,011	Y428C	probably damaging	Het
Oit3	A	T	10: 59,428,239	F358I	probably damaging	Het
Olfr1095	C	T	2: 86,850,994	V235I	probably benign	Het
Olfr794	A	G	10: 129,570,702	T16A	possibly damaging	Het
Paip1	A	G	13: 119,430,217	N29S	probably benign	Het
Pcdhgb4	T	C	18: 37,722,456	S635P	probably benign	Het
Pcsk1	A	G	13: 75,132,179	N708D	possibly damaging	Het
Plch1	C	T	3: 63,781,390	W131*	probably null	Het
Prag1	A	T	8: 36,102,706	M148L	possibly damaging	Het
Ptch1	A	G	13: 63,543,545	L176P	probably damaging	Het
Ralgapa1	A	T	12: 55,747,146	V568D	probably damaging	Het
Rb1	A	T	14: 73,198,534	M897K	probably benign	Het
Robo3	T	A	9: 37,427,027	Q386L	probably damaging	Het
Rtn4rl1	T	C	11: 75,266,002	V420A	possibly damaging	Het
Sall1	A	T	8: 89,030,268	N1069K	probably benign	Het
Sipa1l1	A	G	12: 82,372,468	E640G	probably damaging	Het
Slc22a2	C	A	17: 12,612,410	Y362*	probably null	Het
Slc5a9	T	C	4: 111,880,253	E603G	probably benign	Het
Slc6a17	A	T	3: 107,500,406	I83N	probably damaging	Het
Snx29	G	T	16: 11,403,566	M285I	probably benign	Het
Spata2	T	C	2: 167,484,174	T242A	possibly damaging	Het
Stard13	A	G	5: 151,046,919	L733P	possibly damaging	Het
Svep1	A	G	4: 58,073,045	V2088A	possibly damaging	Het
Tdp2	A	G	13: 24,840,557	E279G	probably damaging	Het
Tnfrsf8	T	G	4: 145,269,224	I422L	probably damaging	Het
Tpk1	T	A	6: 43,346,802	T189S	possibly damaging	Het
Trhde	A	T	10: 114,567,224	M498K	probably damaging	Het
Trim35	T	A	14: 66,303,204	H168Q	possibly damaging	Het
Tubb5	T	C	17: 35,836,455		probably benign	Het
Vmn1r181	G	A	7: 23,984,758	R216Q	probably benign	Het
Vmn2r77	G	A	7: 86,801,823	G306R	probably benign	Het
Xkr4	C	T	1: 3,671,038	R104H	possibly damaging	Het
Zcchc11	C	T	4: 108,478,980	T6I	probably benign	Het
Zfp398	T	C	6: 47,866,421	I337T	possibly damaging	Het

Other mutations in Nin

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00472:Nin	APN	12	70030088	missense	probably damaging	0.98
IGL00677:Nin	APN	12	70026860	missense	probably damaging	1.00
IGL00823:Nin	APN	12	70014793	missense	probably benign	0.01
IGL01103:Nin	APN	12	70056758	missense	probably damaging	0.99
IGL01113:Nin	APN	12	70031779	missense	probably damaging	1.00
IGL01420:Nin	APN	12	70045414	missense	probably benign	0.08
IGL01556:Nin	APN	12	70043188	missense	probably benign	0.01
IGL01663:Nin	APN	12	70043665	missense	possibly damaging	0.72
IGL02002:Nin	APN	12	70062699	nonsense	probably null
IGL02030:Nin	APN	12	70045268	missense	probably damaging	1.00
IGL02202:Nin	APN	12	70055436	missense	probably damaging	1.00
IGL02207:Nin	APN	12	70056657	missense	probably damaging	0.99
IGL02257:Nin	APN	12	70102691	missense	possibly damaging	0.71
IGL02394:Nin	APN	12	70044031	missense	probably damaging	1.00
IGL02531:Nin	APN	12	70020932	missense	probably benign	0.02
IGL03028:Nin	APN	12	70035270	missense	probably benign	0.13
IGL03155:Nin	APN	12	70031770	missense	probably damaging	1.00
IGL03197:Nin	APN	12	70026810	missense	probably benign	0.03
IGL02835:Nin	UTSW	12	70056738	missense	probably damaging	1.00
R0131:Nin	UTSW	12	70051141	missense	probably damaging	1.00
R0131:Nin	UTSW	12	70051141	missense	probably damaging	1.00
R0132:Nin	UTSW	12	70051141	missense	probably damaging	1.00
R0211:Nin	UTSW	12	70014875	missense	probably damaging	1.00
R0211:Nin	UTSW	12	70014875	missense	probably damaging	1.00
R0734:Nin	UTSW	12	70030113	missense	probably benign	0.01
R0947:Nin	UTSW	12	70061186	missense	probably damaging	1.00
R1085:Nin	UTSW	12	70020962	missense	possibly damaging	0.91
R1367:Nin	UTSW	12	70043929	missense	probably damaging	0.99
R1452:Nin	UTSW	12	70017650	nonsense	probably null
R1477:Nin	UTSW	12	70044184	missense	possibly damaging	0.87
R1518:Nin	UTSW	12	70014773	missense	probably benign	0.27
R1566:Nin	UTSW	12	70054479	missense	probably damaging	0.99
R1572:Nin	UTSW	12	70038750	missense	probably damaging	1.00
R1583:Nin	UTSW	12	70031738	missense	probably benign
R1584:Nin	UTSW	12	70042669	missense	probably benign	0.03
R1699:Nin	UTSW	12	70030938	missense	probably benign	0.40
R1699:Nin	UTSW	12	70045563	missense	possibly damaging	0.87
R1765:Nin	UTSW	12	70042891	missense	probably damaging	1.00
R1794:Nin	UTSW	12	70043795	nonsense	probably null
R1952:Nin	UTSW	12	70030926	missense	probably damaging	1.00
R2004:Nin	UTSW	12	70025477	missense	probably benign	0.01
R2025:Nin	UTSW	12	70030008	missense	probably damaging	1.00
R2060:Nin	UTSW	12	70042418	missense	possibly damaging	0.64
R2213:Nin	UTSW	12	70045354	missense	probably damaging	1.00
R2224:Nin	UTSW	12	70061230	missense	probably damaging	1.00
R2247:Nin	UTSW	12	70054545	missense	probably damaging	1.00
R2972:Nin	UTSW	12	70062713	missense	probably damaging	1.00
R3776:Nin	UTSW	12	70038682	missense	possibly damaging	0.71
R3881:Nin	UTSW	12	70042541	missense	probably benign	0.00
R3930:Nin	UTSW	12	70078242	missense	probably damaging	1.00
R3959:Nin	UTSW	12	70050752	missense	probably damaging	1.00
R4229:Nin	UTSW	12	70051210	missense	probably damaging	0.99
R4359:Nin	UTSW	12	70014938	missense	probably benign	0.00
R4423:Nin	UTSW	12	70042978	missense	probably damaging	1.00
R4461:Nin	UTSW	12	70042585	missense	probably benign	0.37
R4639:Nin	UTSW	12	70038601	missense	probably damaging	0.97
R4791:Nin	UTSW	12	70043807	missense	possibly damaging	0.94
R4839:Nin	UTSW	12	70090551	missense	possibly damaging	0.46
R4912:Nin	UTSW	12	70044063	missense	probably damaging	1.00
R5712:Nin	UTSW	12	70042769	missense	probably damaging	1.00
R5726:Nin	UTSW	12	70078179	missense	probably damaging	1.00
R5804:Nin	UTSW	12	70045601	missense	possibly damaging	0.58
R5874:Nin	UTSW	12	70030918	missense	possibly damaging	0.94
R5992:Nin	UTSW	12	70045524	missense	possibly damaging	0.83
R6077:Nin	UTSW	12	70019232	missense	probably damaging	1.00
R6184:Nin	UTSW	12	70043737	missense	probably damaging	1.00
R6307:Nin	UTSW	12	70014857	missense	possibly damaging	0.91
R6315:Nin	UTSW	12	70045615	missense	probably damaging	1.00
R6492:Nin	UTSW	12	70054534	missense	probably benign	0.22
R6562:Nin	UTSW	12	70055954	missense	probably damaging	1.00
R6578:Nin	UTSW	12	70061194	missense	probably damaging	0.99
R6613:Nin	UTSW	12	70030954	missense	probably damaging	1.00
R7112:Nin	UTSW	12	70102799	missense
R7170:Nin	UTSW	12	70044239	missense
R7324:Nin	UTSW	12	70043734	missense
R7338:Nin	UTSW	12	70044064	missense
R7372:Nin	UTSW	12	70056029	missense
R7431:Nin	UTSW	12	70078223	missense
R7577:Nin	UTSW	12	70062706	missense
R7655:Nin	UTSW	12	70042768	missense
R7656:Nin	UTSW	12	70042768	missense
R7683:Nin	UTSW	12	70078182	missense
R7769:Nin	UTSW	12	70043230	missense
R7981:Nin	UTSW	12	70042817	missense
R8138:Nin	UTSW	12	70042898	missense
R8141:Nin	UTSW	12	70030021	missense
R8754:Nin	UTSW	12	70031013	intron	probably benign
R8790:Nin	UTSW	12	70021019	missense
R8899:Nin	UTSW	12	70030936	missense	probably damaging	1.00
R8974:Nin	UTSW	12	70078158	missense
R9085:Nin	UTSW	12	70030012	nonsense	probably null
R9143:Nin	UTSW	12	70090575	missense
R9380:Nin	UTSW	12	70028031	missense
Z1176:Nin	UTSW	12	70049164	critical splice acceptor site	probably null
Z1177:Nin	UTSW	12	70044095	missense
Z1177:Nin	UTSW	12	70054426	missense

Predicted Primers

PCR Primer
(F):5'- GGAGACTTCCTGGTGAACAAG -3'
(R):5'- AAAAGGCTCAGCTCCAGGAG -3'

Sequencing Primer
(F):5'- TTCCTGGTGAACAAGACAAAACTAG -3'
(R):5'- CATGAGAGGGAGCTCCAGGC -3'

Posted On

2018-04-02