Incidental Mutation 'R6326:Paip1'
ID510440
Institutional Source Beutler Lab
Gene Symbol Paip1
Ensembl Gene ENSMUSG00000025451
Gene Namepolyadenylate binding protein-interacting protein 1
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.247) question?
Stock #R6326 (G1)
Quality Score225.009
Status Not validated
Chromosome13
Chromosomal Location119428601-119458218 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 119430217 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 29 (N29S)
Ref Sequence ENSEMBL: ENSMUSP00000134051 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026520] [ENSMUST00000109203] [ENSMUST00000126957] [ENSMUST00000173627]
Predicted Effect probably benign
Transcript: ENSMUST00000026520
AA Change: N29S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000026520
Gene: ENSMUSG00000025451
AA Change: N29S

DomainStartEndE-ValueType
Pfam:PAM2 44 61 8.9e-8 PFAM
MIF4G 80 297 2.62e-46 SMART
low complexity region 373 385 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000109203
SMART Domains Protein: ENSMUSP00000104826
Gene: ENSMUSG00000025451

DomainStartEndE-ValueType
Pfam:PAM2 11 28 3.7e-7 PFAM
MIF4G 47 264 2.62e-46 SMART
low complexity region 340 352 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000126957
AA Change: N113S

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000117256
Gene: ENSMUSG00000025451
AA Change: N113S

DomainStartEndE-ValueType
low complexity region 7 38 N/A INTRINSIC
low complexity region 44 74 N/A INTRINSIC
low complexity region 79 91 N/A INTRINSIC
Pfam:PAM2 128 145 3.3e-7 PFAM
MIF4G 164 381 2.62e-46 SMART
low complexity region 457 469 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000132304
AA Change: N117S
SMART Domains Protein: ENSMUSP00000134617
Gene: ENSMUSG00000025451
AA Change: N117S

DomainStartEndE-ValueType
low complexity region 7 38 N/A INTRINSIC
low complexity region 44 74 N/A INTRINSIC
low complexity region 79 91 N/A INTRINSIC
Pfam:PAM2 128 145 6.8e-5 PFAM
Pfam:MIF4G 164 267 1.9e-15 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000173627
AA Change: N29S

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000134051
Gene: ENSMUSG00000025451
AA Change: N29S

DomainStartEndE-ValueType
Pfam:PAM2 44 61 3.6e-7 PFAM
MIF4G 80 297 2.62e-46 SMART
Predicted Effect unknown
Transcript: ENSMUST00000174691
AA Change: N20S
SMART Domains Protein: ENSMUSP00000134502
Gene: ENSMUSG00000025451
AA Change: N20S

DomainStartEndE-ValueType
Pfam:PAM2 36 53 2.4e-7 PFAM
Pfam:MIF4G 72 207 1.6e-27 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene interacts with poly(A)-binding protein and with the cap-binding complex eIF4A. It is involved in translational initiation and protein biosynthesis. Overexpression of this gene in COS7 cells stimulates translation. Alternative splicing occurs at this locus and three transcript variants encoding three distinct isoforms have been identified. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110032A03Rik T G 9: 50,764,757 N87T probably damaging Het
2810474O19Rik T A 6: 149,328,995 Y1180N probably damaging Het
Adamts17 A T 7: 67,120,888 Y915F probably benign Het
Adap2 T A 11: 80,155,022 F43I probably damaging Het
Adprhl2 A T 4: 126,316,613 L358Q possibly damaging Het
AI314180 T A 4: 58,827,068 T1022S probably benign Het
Akap9 A C 5: 3,962,061 Q921H probably damaging Het
Amigo2 A G 15: 97,245,375 S389P probably benign Het
Atg2b A T 12: 105,661,092 C545* probably null Het
C2cd3 A G 7: 100,416,428 E807G probably benign Het
Ccdc110 A G 8: 45,942,041 E323G probably damaging Het
Cdk5rap2 T A 4: 70,235,454 S1711C probably damaging Het
Cebpzos T G 17: 78,919,057 D39E probably damaging Het
Cenpe A G 3: 135,239,778 N1018D probably benign Het
Clspn C A 4: 126,565,739 H141Q probably damaging Het
Cluh C T 11: 74,666,242 A1010V probably benign Het
Col27a1 G T 4: 63,324,441 probably benign Het
Cpt2 T C 4: 107,914,316 M61V probably benign Het
Ddr2 T A 1: 169,987,140 H578L probably damaging Het
Dnah14 T A 1: 181,783,556 I3749N probably damaging Het
Dnajc18 T C 18: 35,680,925 T264A possibly damaging Het
Eml6 T C 11: 29,819,066 N693S probably damaging Het
Ephx4 A G 5: 107,406,111 E9G probably damaging Het
Eps15l1 G A 8: 72,341,434 Q747* probably null Het
Flrt1 C T 19: 7,096,609 S191N probably damaging Het
Gm5114 C T 7: 39,408,155 R680H probably benign Het
Gm5431 T C 11: 48,889,345 H250R probably damaging Het
Gm7233 T C 14: 43,182,885 C198R possibly damaging Het
Herc2 C G 7: 56,222,934 Q4407E probably damaging Het
Hmx3 C G 7: 131,543,005 probably benign Het
Hoxb7 C A 11: 96,287,083 A119E probably benign Het
Ifi207 A T 1: 173,729,966 M402K probably benign Het
Ints14 T C 9: 64,964,437 V19A probably benign Het
Itgae T A 11: 73,131,693 N911K possibly damaging Het
Kif1a T C 1: 93,076,326 S145G probably damaging Het
Klhdc4 A G 8: 121,805,054 W187R probably damaging Het
Krt1 A T 15: 101,850,249 I160N probably damaging Het
Krt12 T C 11: 99,416,919 T448A probably benign Het
Lcmt2 G A 2: 121,139,457 R382* probably null Het
Map3k8 C T 18: 4,340,651 S221N probably damaging Het
Med17 T C 9: 15,279,558 D79G probably benign Het
Mlf1 A T 3: 67,399,727 I257F probably damaging Het
Mov10l1 T A 15: 88,994,895 F153I probably damaging Het
Msto1 A C 3: 88,912,098 V149G probably damaging Het
Mybl1 T C 1: 9,678,507 probably null Het
Myoc A G 1: 162,649,011 Y428C probably damaging Het
Nin A G 12: 70,045,181 S785P possibly damaging Het
Oit3 A T 10: 59,428,239 F358I probably damaging Het
Olfr1095 C T 2: 86,850,994 V235I probably benign Het
Olfr794 A G 10: 129,570,702 T16A possibly damaging Het
Pcdhgb4 T C 18: 37,722,456 S635P probably benign Het
Pcsk1 A G 13: 75,132,179 N708D possibly damaging Het
Plch1 C T 3: 63,781,390 W131* probably null Het
Prag1 A T 8: 36,102,706 M148L possibly damaging Het
Ptch1 A G 13: 63,543,545 L176P probably damaging Het
Ralgapa1 A T 12: 55,747,146 V568D probably damaging Het
Rb1 A T 14: 73,198,534 M897K probably benign Het
Robo3 T A 9: 37,427,027 Q386L probably damaging Het
Rtn4rl1 T C 11: 75,266,002 V420A possibly damaging Het
Sall1 A T 8: 89,030,268 N1069K probably benign Het
Sipa1l1 A G 12: 82,372,468 E640G probably damaging Het
Slc22a2 C A 17: 12,612,410 Y362* probably null Het
Slc5a9 T C 4: 111,880,253 E603G probably benign Het
Slc6a17 A T 3: 107,500,406 I83N probably damaging Het
Snx29 G T 16: 11,403,566 M285I probably benign Het
Spata2 T C 2: 167,484,174 T242A possibly damaging Het
Stard13 A G 5: 151,046,919 L733P possibly damaging Het
Svep1 A G 4: 58,073,045 V2088A possibly damaging Het
Tdp2 A G 13: 24,840,557 E279G probably damaging Het
Tnfrsf8 T G 4: 145,269,224 I422L probably damaging Het
Tpk1 T A 6: 43,346,802 T189S possibly damaging Het
Trhde A T 10: 114,567,224 M498K probably damaging Het
Trim35 T A 14: 66,303,204 H168Q possibly damaging Het
Tubb5 T C 17: 35,836,455 probably benign Het
Vmn1r181 G A 7: 23,984,758 R216Q probably benign Het
Vmn2r77 G A 7: 86,801,823 G306R probably benign Het
Xkr4 C T 1: 3,671,038 R104H possibly damaging Het
Zcchc11 C T 4: 108,478,980 T6I probably benign Het
Zfp398 T C 6: 47,866,421 I337T possibly damaging Het
Other mutations in Paip1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02668:Paip1 APN 13 119438071 missense probably damaging 1.00
IGL02873:Paip1 APN 13 119445812 missense possibly damaging 0.95
R0517:Paip1 UTSW 13 119447790 missense probably damaging 1.00
R0791:Paip1 UTSW 13 119430318 missense possibly damaging 0.69
R0792:Paip1 UTSW 13 119430318 missense possibly damaging 0.69
R1419:Paip1 UTSW 13 119457017 missense probably damaging 0.99
R1572:Paip1 UTSW 13 119451784 unclassified probably benign
R1935:Paip1 UTSW 13 119457014 missense probably damaging 1.00
R1936:Paip1 UTSW 13 119457014 missense probably damaging 1.00
R2072:Paip1 UTSW 13 119430262 missense possibly damaging 0.88
R3827:Paip1 UTSW 13 119430232 start codon destroyed probably null 0.47
R4082:Paip1 UTSW 13 119457004 missense probably damaging 1.00
R4092:Paip1 UTSW 13 119449913 missense probably benign 0.02
R4854:Paip1 UTSW 13 119449889 splice site probably benign
R5012:Paip1 UTSW 13 119447802 missense probably benign
R5103:Paip1 UTSW 13 119437979 missense possibly damaging 0.95
R5425:Paip1 UTSW 13 119430166 missense possibly damaging 0.60
R5592:Paip1 UTSW 13 119450798 missense probably damaging 1.00
R5851:Paip1 UTSW 13 119440765 missense possibly damaging 0.94
R5929:Paip1 UTSW 13 119445790 missense probably damaging 1.00
R5976:Paip1 UTSW 13 119456997 missense probably damaging 1.00
R6021:Paip1 UTSW 13 119457135 frame shift probably null
R6964:Paip1 UTSW 13 119450770 missense possibly damaging 0.61
R7544:Paip1 UTSW 13 119445801 missense probably damaging 1.00
R7552:Paip1 UTSW 13 119440820 missense possibly damaging 0.83
R7659:Paip1 UTSW 13 119450770 missense possibly damaging 0.61
R7660:Paip1 UTSW 13 119450770 missense possibly damaging 0.61
R7661:Paip1 UTSW 13 119450770 missense possibly damaging 0.61
R7984:Paip1 UTSW 13 119430162 nonsense probably null
R8294:Paip1 UTSW 13 119450764 missense possibly damaging 0.95
R8884:Paip1 UTSW 13 119438017 missense probably damaging 1.00
R8888:Paip1 UTSW 13 119430265 missense probably benign 0.02
R8895:Paip1 UTSW 13 119430265 missense probably benign 0.02
Z1177:Paip1 UTSW 13 119447808 missense probably benign 0.16
Predicted Primers PCR Primer
(F):5'- GTTCTCAGACGGTTTCTAAATCTG -3'
(R):5'- GCAGCCAGCATACTCTAGTG -3'

Sequencing Primer
(F):5'- CGGTTTCTAAATCTGTAGTAAGTTGC -3'
(R):5'- TTCGCAGACAGCTTAGAC -3'
Posted On2018-04-02