Incidental Mutation 'R6326:Rb1'
ID510443
Institutional Source Beutler Lab
Gene Symbol Rb1
Ensembl Gene ENSMUSG00000022105
Gene NameRB transcriptional corepressor 1
SynonymsRb-1, Rb, pRb
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6326 (G1)
Quality Score225.009
Status Not validated
Chromosome14
Chromosomal Location73183673-73325822 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 73198534 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 897 (M897K)
Ref Sequence ENSEMBL: ENSMUSP00000022701 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022701] [ENSMUST00000171767]
Predicted Effect probably benign
Transcript: ENSMUST00000022701
AA Change: M897K

PolyPhen 2 Score 0.058 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000022701
Gene: ENSMUSG00000022105
AA Change: M897K

DomainStartEndE-ValueType
low complexity region 2 28 N/A INTRINSIC
low complexity region 37 53 N/A INTRINSIC
DUF3452 97 223 4.59e-25 SMART
RB_A 367 567 5.53e-92 SMART
CYCLIN 653 740 1.62e-5 SMART
Rb_C 761 920 1.28e-96 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000163932
Predicted Effect noncoding transcript
Transcript: ENSMUST00000168495
Predicted Effect probably benign
Transcript: ENSMUST00000171767
SMART Domains Protein: ENSMUSP00000127397
Gene: ENSMUSG00000022106

DomainStartEndE-ValueType
Pfam:RCC1 117 167 1.7e-16 PFAM
Pfam:RCC1_2 154 183 4.9e-15 PFAM
Pfam:RCC1 170 220 8.4e-16 PFAM
Pfam:RCC1 223 272 5.5e-18 PFAM
Pfam:RCC1_2 259 288 1.7e-11 PFAM
Pfam:RCC1 275 324 6.8e-14 PFAM
BTB 394 487 2.69e-21 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a negative regulator of the cell cycle and was the first tumor suppressor gene found. The encoded protein also stabilizes constitutive heterochromatin to maintain the overall chromatin structure. The active, hypophosphorylated form of the protein binds transcription factor E2F1. Defects in this gene are a cause of childhood cancer retinoblastoma (RB), bladder cancer, and osteogenic sarcoma. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted mutations exhibit abnormalities of the neuronal and hematopoietic systems and die in utero. Heterozygotes may develop pituitary tumors associated with loss of the normal allele. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110032A03Rik T G 9: 50,764,757 N87T probably damaging Het
2810474O19Rik T A 6: 149,328,995 Y1180N probably damaging Het
Adamts17 A T 7: 67,120,888 Y915F probably benign Het
Adap2 T A 11: 80,155,022 F43I probably damaging Het
Adprhl2 A T 4: 126,316,613 L358Q possibly damaging Het
AI314180 T A 4: 58,827,068 T1022S probably benign Het
Akap9 A C 5: 3,962,061 Q921H probably damaging Het
Amigo2 A G 15: 97,245,375 S389P probably benign Het
Atg2b A T 12: 105,661,092 C545* probably null Het
C2cd3 A G 7: 100,416,428 E807G probably benign Het
Ccdc110 A G 8: 45,942,041 E323G probably damaging Het
Cdk5rap2 T A 4: 70,235,454 S1711C probably damaging Het
Cebpzos T G 17: 78,919,057 D39E probably damaging Het
Cenpe A G 3: 135,239,778 N1018D probably benign Het
Clspn C A 4: 126,565,739 H141Q probably damaging Het
Cluh C T 11: 74,666,242 A1010V probably benign Het
Col27a1 G T 4: 63,324,441 probably benign Het
Cpt2 T C 4: 107,914,316 M61V probably benign Het
Ddr2 T A 1: 169,987,140 H578L probably damaging Het
Dnah14 T A 1: 181,783,556 I3749N probably damaging Het
Dnajc18 T C 18: 35,680,925 T264A possibly damaging Het
Eml6 T C 11: 29,819,066 N693S probably damaging Het
Ephx4 A G 5: 107,406,111 E9G probably damaging Het
Eps15l1 G A 8: 72,341,434 Q747* probably null Het
Flrt1 C T 19: 7,096,609 S191N probably damaging Het
Gm5114 C T 7: 39,408,155 R680H probably benign Het
Gm5431 T C 11: 48,889,345 H250R probably damaging Het
Gm7233 T C 14: 43,182,885 C198R possibly damaging Het
Herc2 C G 7: 56,222,934 Q4407E probably damaging Het
Hmx3 C G 7: 131,543,005 probably benign Het
Hoxb7 C A 11: 96,287,083 A119E probably benign Het
Ifi207 A T 1: 173,729,966 M402K probably benign Het
Ints14 T C 9: 64,964,437 V19A probably benign Het
Itgae T A 11: 73,131,693 N911K possibly damaging Het
Kif1a T C 1: 93,076,326 S145G probably damaging Het
Klhdc4 A G 8: 121,805,054 W187R probably damaging Het
Krt1 A T 15: 101,850,249 I160N probably damaging Het
Krt12 T C 11: 99,416,919 T448A probably benign Het
Lcmt2 G A 2: 121,139,457 R382* probably null Het
Map3k8 C T 18: 4,340,651 S221N probably damaging Het
Med17 T C 9: 15,279,558 D79G probably benign Het
Mlf1 A T 3: 67,399,727 I257F probably damaging Het
Mov10l1 T A 15: 88,994,895 F153I probably damaging Het
Msto1 A C 3: 88,912,098 V149G probably damaging Het
Mybl1 T C 1: 9,678,507 probably null Het
Myoc A G 1: 162,649,011 Y428C probably damaging Het
Nin A G 12: 70,045,181 S785P possibly damaging Het
Oit3 A T 10: 59,428,239 F358I probably damaging Het
Olfr1095 C T 2: 86,850,994 V235I probably benign Het
Olfr794 A G 10: 129,570,702 T16A possibly damaging Het
Paip1 A G 13: 119,430,217 N29S probably benign Het
Pcdhgb4 T C 18: 37,722,456 S635P probably benign Het
Pcsk1 A G 13: 75,132,179 N708D possibly damaging Het
Plch1 C T 3: 63,781,390 W131* probably null Het
Prag1 A T 8: 36,102,706 M148L possibly damaging Het
Ptch1 A G 13: 63,543,545 L176P probably damaging Het
Ralgapa1 A T 12: 55,747,146 V568D probably damaging Het
Robo3 T A 9: 37,427,027 Q386L probably damaging Het
Rtn4rl1 T C 11: 75,266,002 V420A possibly damaging Het
Sall1 A T 8: 89,030,268 N1069K probably benign Het
Sipa1l1 A G 12: 82,372,468 E640G probably damaging Het
Slc22a2 C A 17: 12,612,410 Y362* probably null Het
Slc5a9 T C 4: 111,880,253 E603G probably benign Het
Slc6a17 A T 3: 107,500,406 I83N probably damaging Het
Snx29 G T 16: 11,403,566 M285I probably benign Het
Spata2 T C 2: 167,484,174 T242A possibly damaging Het
Stard13 A G 5: 151,046,919 L733P possibly damaging Het
Svep1 A G 4: 58,073,045 V2088A possibly damaging Het
Tdp2 A G 13: 24,840,557 E279G probably damaging Het
Tnfrsf8 T G 4: 145,269,224 I422L probably damaging Het
Tpk1 T A 6: 43,346,802 T189S possibly damaging Het
Trhde A T 10: 114,567,224 M498K probably damaging Het
Trim35 T A 14: 66,303,204 H168Q possibly damaging Het
Tubb5 T C 17: 35,836,455 probably benign Het
Vmn1r181 G A 7: 23,984,758 R216Q probably benign Het
Vmn2r77 G A 7: 86,801,823 G306R probably benign Het
Xkr4 C T 1: 3,671,038 R104H possibly damaging Het
Zcchc11 C T 4: 108,478,980 T6I probably benign Het
Zfp398 T C 6: 47,866,421 I337T possibly damaging Het
Other mutations in Rb1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00497:Rb1 APN 14 73264598 missense probably damaging 1.00
IGL00951:Rb1 APN 14 73322072 missense probably damaging 1.00
IGL01152:Rb1 APN 14 73205870 missense probably damaging 1.00
IGL01339:Rb1 APN 14 73264371 critical splice acceptor site probably null
IGL01349:Rb1 APN 14 73269118 missense probably damaging 1.00
IGL01390:Rb1 APN 14 73294999 missense probably benign 0.02
IGL02066:Rb1 APN 14 73198534 missense probably benign 0.06
IGL02207:Rb1 APN 14 73206085 missense probably damaging 1.00
IGL02860:Rb1 APN 14 73206012 missense probably damaging 1.00
IGL03370:Rb1 APN 14 73282866 critical splice donor site probably null
rubidium UTSW 14 73199311 missense probably damaging 1.00
P0028:Rb1 UTSW 14 73264628 missense probably damaging 1.00
R0553:Rb1 UTSW 14 73211712 nonsense probably null
R0563:Rb1 UTSW 14 73216767 missense probably damaging 1.00
R0586:Rb1 UTSW 14 73287684 intron probably benign
R0595:Rb1 UTSW 14 73273680 missense probably damaging 1.00
R0755:Rb1 UTSW 14 73197213 makesense probably null
R1480:Rb1 UTSW 14 73262602 missense probably benign
R1513:Rb1 UTSW 14 73322084 missense probably benign 0.00
R1752:Rb1 UTSW 14 73287624 missense probably damaging 0.99
R1919:Rb1 UTSW 14 73212990 nonsense probably null
R2010:Rb1 UTSW 14 73294993 missense probably benign 0.16
R2087:Rb1 UTSW 14 73280252 missense probably benign 0.09
R2152:Rb1 UTSW 14 73288725 missense probably benign
R2167:Rb1 UTSW 14 73211651 missense probably damaging 1.00
R3950:Rb1 UTSW 14 73262662 missense probably damaging 1.00
R4183:Rb1 UTSW 14 73198526 splice site probably null
R4225:Rb1 UTSW 14 73269191 missense possibly damaging 0.58
R4306:Rb1 UTSW 14 73262695 missense probably damaging 1.00
R4464:Rb1 UTSW 14 73199198 intron probably null
R4609:Rb1 UTSW 14 73262514 splice site probably benign
R4671:Rb1 UTSW 14 73273676 missense probably damaging 1.00
R4916:Rb1 UTSW 14 73216691 missense probably damaging 1.00
R5160:Rb1 UTSW 14 73264455 synonymous silent
R5210:Rb1 UTSW 14 73199311 missense probably damaging 1.00
R5320:Rb1 UTSW 14 73213126 nonsense probably null
R5436:Rb1 UTSW 14 73213140 splice site probably null
R5467:Rb1 UTSW 14 73211620 missense possibly damaging 0.92
R5592:Rb1 UTSW 14 73211747 missense probably damaging 1.00
R6363:Rb1 UTSW 14 73287641 missense probably benign 0.01
R6395:Rb1 UTSW 14 73199196 missense probably damaging 1.00
R6414:Rb1 UTSW 14 73282974 missense unknown
R6460:Rb1 UTSW 14 73278454 missense probably benign 0.06
R6503:Rb1 UTSW 14 73205880 missense probably benign 0.08
R6519:Rb1 UTSW 14 73298063 missense probably benign 0.00
R6671:Rb1 UTSW 14 73197266 missense probably damaging 1.00
R7026:Rb1 UTSW 14 73298099 missense probably benign 0.00
R7103:Rb1 UTSW 14 73262644 missense probably damaging 1.00
R7263:Rb1 UTSW 14 73282923 nonsense probably null
R7478:Rb1 UTSW 14 73269137 missense probably damaging 1.00
R7519:Rb1 UTSW 14 73264608 missense probably damaging 1.00
R7817:Rb1 UTSW 14 73198543 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CACACTTAGTCTACCAATGTGTGAG -3'
(R):5'- GCATGGACTTACACAGCTATTG -3'

Sequencing Primer
(F):5'- GTCTACCAATGTGTGAGGTAAATTG -3'
(R):5'- CACAGCTATTGATACAAATTTG -3'
Posted On2018-04-02