Incidental Mutation 'R6327:Pamr1'
ID510457
Institutional Source Beutler Lab
Gene Symbol Pamr1
Ensembl Gene ENSMUSG00000027188
Gene Namepeptidase domain containing associated with muscle regeneration 1
SynonymsRAMP, E430002G05Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.099) question?
Stock #R6327 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location102550012-102643041 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 102642174 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 606 (D606V)
Ref Sequence ENSEMBL: ENSMUSP00000028612 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028612]
Predicted Effect probably damaging
Transcript: ENSMUST00000028612
AA Change: D606V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000028612
Gene: ENSMUSG00000027188
AA Change: D606V

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
EGF 84 126 1.18e1 SMART
CUB 128 236 1.07e-33 SMART
EGF 238 272 4.12e-7 SMART
CCP 280 342 1.3e-9 SMART
CCP 389 442 6.7e-3 SMART
Tryp_SPc 444 715 1.02e-34 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143071
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.4%
Validation Efficiency 100% (43/43)
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2ml1 T C 6: 128,558,692 probably null Het
Birc6 C A 17: 74,662,779 H383Q probably damaging Het
C2 C A 17: 34,864,103 A431S probably benign Het
C3ar1 C T 6: 122,850,146 V371M probably damaging Het
Chd1l G A 3: 97,587,167 A399V probably damaging Het
Ckap2l A G 2: 129,285,494 S255P probably damaging Het
Clca3a1 T A 3: 144,730,797 I842F probably benign Het
Cmc2 G T 8: 116,894,157 H28Q probably damaging Het
Col11a2 C T 17: 34,043,317 P176L probably benign Het
Csmd3 T C 15: 47,881,387 D1404G probably damaging Het
Dld G A 12: 31,332,191 P506S probably benign Het
Dsg3 T C 18: 20,539,870 M866T probably benign Het
Ehd1 T C 19: 6,298,345 I451T possibly damaging Het
Fosb T C 7: 19,307,227 T114A probably benign Het
Foxd4 T A 19: 24,900,834 M1L possibly damaging Het
Fstl5 T A 3: 76,707,801 I723N probably benign Het
Gm10549 C A 18: 33,464,305 probably benign Het
Gm11595 G A 11: 99,772,555 R100C unknown Het
Hdlbp A G 1: 93,429,464 S299P possibly damaging Het
Mast4 G A 13: 102,761,382 R650C probably damaging Het
Micu3 A G 8: 40,366,197 T306A probably benign Het
Mylk2 A G 2: 152,913,693 Q259R possibly damaging Het
Nfkbiz T C 16: 55,821,962 N31S probably damaging Het
Nisch A T 14: 31,171,487 probably benign Het
Nudt17 T C 3: 96,707,764 probably benign Het
Olfr1389 A C 11: 49,431,001 H175P probably damaging Het
Olfr292 T C 7: 86,694,552 V32A probably benign Het
Olfr541 T C 7: 140,704,703 W151R probably damaging Het
Oprm1 A C 10: 6,830,063 I242L probably damaging Het
Otud6b A G 4: 14,826,496 probably benign Het
Pcf11 T C 7: 92,659,609 probably benign Het
Pom121l2 T C 13: 21,982,332 S258P probably damaging Het
Rcsd1 T A 1: 165,655,834 D196V possibly damaging Het
Sbf2 C T 7: 110,441,552 R356Q probably damaging Het
Serpinf1 A G 11: 75,413,905 probably null Het
Slc22a30 T G 19: 8,335,722 probably benign Het
Strn4 G T 7: 16,816,459 S36I probably benign Het
Taar6 A G 10: 23,985,279 L123P probably damaging Het
Thbs1 G T 2: 118,112,656 R5L unknown Het
Timp3 T C 10: 86,345,786 Y174H probably benign Het
Trpm2 C T 10: 77,932,227 V813M probably damaging Het
Uox C T 3: 146,624,577 R163* probably null Het
Vcan A T 13: 89,704,832 S670T probably damaging Het
Vmn1r65 A T 7: 6,008,652 N194K possibly damaging Het
Other mutations in Pamr1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00503:Pamr1 APN 2 102642272 missense possibly damaging 0.80
IGL00741:Pamr1 APN 2 102586621 missense possibly damaging 0.62
IGL00928:Pamr1 APN 2 102639341 missense probably benign 0.01
IGL01328:Pamr1 APN 2 102642137 missense probably benign 0.00
IGL02621:Pamr1 APN 2 102634343 missense probably benign 0.03
IGL02732:Pamr1 APN 2 102642141 missense probably benign 0.03
R0020:Pamr1 UTSW 2 102642078 missense probably benign 0.19
R0743:Pamr1 UTSW 2 102609907 missense probably damaging 1.00
R1068:Pamr1 UTSW 2 102642245 missense probably damaging 1.00
R1127:Pamr1 UTSW 2 102639353 missense possibly damaging 0.81
R1711:Pamr1 UTSW 2 102640852 missense probably benign 0.28
R1912:Pamr1 UTSW 2 102642300 missense probably damaging 1.00
R1926:Pamr1 UTSW 2 102640997 intron probably null
R1937:Pamr1 UTSW 2 102642272 missense possibly damaging 0.80
R2021:Pamr1 UTSW 2 102634535 missense probably benign 0.00
R2023:Pamr1 UTSW 2 102634535 missense probably benign 0.00
R4718:Pamr1 UTSW 2 102642336 missense probably damaging 1.00
R4934:Pamr1 UTSW 2 102642204 missense probably benign 0.21
R5268:Pamr1 UTSW 2 102586684 missense probably damaging 0.98
R5450:Pamr1 UTSW 2 102639317 missense probably damaging 0.98
R5864:Pamr1 UTSW 2 102634348 missense possibly damaging 0.91
R6112:Pamr1 UTSW 2 102611608 missense probably damaging 1.00
R6286:Pamr1 UTSW 2 102640948 nonsense probably null
R6831:Pamr1 UTSW 2 102614931 missense probably damaging 0.97
R6834:Pamr1 UTSW 2 102614931 missense probably damaging 0.97
R6980:Pamr1 UTSW 2 102642204 missense probably benign 0.21
R7000:Pamr1 UTSW 2 102611623 missense probably damaging 1.00
R7073:Pamr1 UTSW 2 102640935 missense probably benign 0.00
R7255:Pamr1 UTSW 2 102611584 missense probably damaging 1.00
R7357:Pamr1 UTSW 2 102586704 nonsense probably null
R7851:Pamr1 UTSW 2 102586600 missense probably benign 0.02
R7934:Pamr1 UTSW 2 102586600 missense probably benign 0.02
X0067:Pamr1 UTSW 2 102639335 nonsense probably null
Z1088:Pamr1 UTSW 2 102634446 missense possibly damaging 0.84
Predicted Primers PCR Primer
(F):5'- GCTGACTGTTTACCACTGGTATC -3'
(R):5'- TGCAGTGCAGATGTCAGAAG -3'

Sequencing Primer
(F):5'- ATCATTCTGCACCCCAACTATG -3'
(R):5'- CAGAAGGGGTACTGGGATCTTTGC -3'
Posted On2018-04-02