Incidental Mutation 'R6327:Ckap2l'
ID510459
Institutional Source Beutler Lab
Gene Symbol Ckap2l
Ensembl Gene ENSMUSG00000048327
Gene Namecytoskeleton associated protein 2-like
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.456) question?
Stock #R6327 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location129268210-129297212 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 129285494 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 255 (S255P)
Ref Sequence ENSEMBL: ENSMUSP00000056145 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000052708]
Predicted Effect probably damaging
Transcript: ENSMUST00000052708
AA Change: S255P

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000056145
Gene: ENSMUSG00000048327
AA Change: S255P

DomainStartEndE-ValueType
low complexity region 45 58 N/A INTRINSIC
Pfam:CKAP2_C 425 644 3e-32 PFAM
Pfam:CKAP2_C 675 734 6.9e-18 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.4%
Validation Efficiency 100% (43/43)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is thought to be a mitotic spindle protein important to neural stem or progenitor cells. Mutations in this gene have been associated with spindle organization defects, including mitotic spindle defects, lagging chromosomes, and chromatin bridges. There is evidence that mutations in this gene are associated with Filippi syndrome, characterized by growth defects, microcephaly, intellectual disability, facial feature defects, and syndactyly. There is a pseudogene of this gene on chromosome 20. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2015]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2ml1 T C 6: 128,558,692 probably null Het
Birc6 C A 17: 74,662,779 H383Q probably damaging Het
C2 C A 17: 34,864,103 A431S probably benign Het
C3ar1 C T 6: 122,850,146 V371M probably damaging Het
Chd1l G A 3: 97,587,167 A399V probably damaging Het
Clca3a1 T A 3: 144,730,797 I842F probably benign Het
Cmc2 G T 8: 116,894,157 H28Q probably damaging Het
Col11a2 C T 17: 34,043,317 P176L probably benign Het
Csmd3 T C 15: 47,881,387 D1404G probably damaging Het
Dld G A 12: 31,332,191 P506S probably benign Het
Dsg3 T C 18: 20,539,870 M866T probably benign Het
Ehd1 T C 19: 6,298,345 I451T possibly damaging Het
Fosb T C 7: 19,307,227 T114A probably benign Het
Foxd4 T A 19: 24,900,834 M1L possibly damaging Het
Fstl5 T A 3: 76,707,801 I723N probably benign Het
Gm10549 C A 18: 33,464,305 probably benign Het
Gm11595 G A 11: 99,772,555 R100C unknown Het
Hdlbp A G 1: 93,429,464 S299P possibly damaging Het
Mast4 G A 13: 102,761,382 R650C probably damaging Het
Micu3 A G 8: 40,366,197 T306A probably benign Het
Mylk2 A G 2: 152,913,693 Q259R possibly damaging Het
Nfkbiz T C 16: 55,821,962 N31S probably damaging Het
Nisch A T 14: 31,171,487 probably benign Het
Nudt17 T C 3: 96,707,764 probably benign Het
Olfr1389 A C 11: 49,431,001 H175P probably damaging Het
Olfr292 T C 7: 86,694,552 V32A probably benign Het
Olfr541 T C 7: 140,704,703 W151R probably damaging Het
Oprm1 A C 10: 6,830,063 I242L probably damaging Het
Otud6b A G 4: 14,826,496 probably benign Het
Pamr1 A T 2: 102,642,174 D606V probably damaging Het
Pcf11 T C 7: 92,659,609 probably benign Het
Pom121l2 T C 13: 21,982,332 S258P probably damaging Het
Rcsd1 T A 1: 165,655,834 D196V possibly damaging Het
Sbf2 C T 7: 110,441,552 R356Q probably damaging Het
Serpinf1 A G 11: 75,413,905 probably null Het
Slc22a30 T G 19: 8,335,722 probably benign Het
Strn4 G T 7: 16,816,459 S36I probably benign Het
Taar6 A G 10: 23,985,279 L123P probably damaging Het
Thbs1 G T 2: 118,112,656 R5L unknown Het
Timp3 T C 10: 86,345,786 Y174H probably benign Het
Trpm2 C T 10: 77,932,227 V813M probably damaging Het
Uox C T 3: 146,624,577 R163* probably null Het
Vcan A T 13: 89,704,832 S670T probably damaging Het
Vmn1r65 A T 7: 6,008,652 N194K possibly damaging Het
Other mutations in Ckap2l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01401:Ckap2l APN 2 129269216 missense probably damaging 1.00
IGL02120:Ckap2l APN 2 129285622 missense possibly damaging 0.58
IGL03085:Ckap2l APN 2 129285047 missense probably benign 0.00
IGL03175:Ckap2l APN 2 129285517 missense probably benign 0.01
IGL03333:Ckap2l APN 2 129296308 splice site probably null
R0196:Ckap2l UTSW 2 129285422 missense probably benign 0.43
R0501:Ckap2l UTSW 2 129285491 missense possibly damaging 0.78
R0715:Ckap2l UTSW 2 129285716 missense probably benign 0.02
R0834:Ckap2l UTSW 2 129296304 splice site probably benign
R1119:Ckap2l UTSW 2 129272572 splice site probably benign
R1561:Ckap2l UTSW 2 129270725 missense probably benign 0.01
R1677:Ckap2l UTSW 2 129285167 missense possibly damaging 0.86
R1823:Ckap2l UTSW 2 129275579 missense probably damaging 1.00
R1971:Ckap2l UTSW 2 129285422 missense possibly damaging 0.92
R4803:Ckap2l UTSW 2 129269256 missense probably damaging 1.00
R5214:Ckap2l UTSW 2 129285469 missense probably benign 0.02
R5264:Ckap2l UTSW 2 129285379 missense probably benign 0.01
R5297:Ckap2l UTSW 2 129285370 missense possibly damaging 0.56
R5535:Ckap2l UTSW 2 129285842 missense probably benign 0.00
R5606:Ckap2l UTSW 2 129286039 missense probably damaging 0.98
R6489:Ckap2l UTSW 2 129269114 missense possibly damaging 0.85
R6726:Ckap2l UTSW 2 129269194 missense probably damaging 1.00
R7199:Ckap2l UTSW 2 129285055 missense probably benign 0.25
R7220:Ckap2l UTSW 2 129275516 missense probably damaging 1.00
R7329:Ckap2l UTSW 2 129285364 missense possibly damaging 0.56
R7374:Ckap2l UTSW 2 129284963 missense probably damaging 1.00
R7383:Ckap2l UTSW 2 129269252 missense possibly damaging 0.88
R7484:Ckap2l UTSW 2 129272535 missense possibly damaging 0.82
R7611:Ckap2l UTSW 2 129285680 missense possibly damaging 0.88
R7868:Ckap2l UTSW 2 129285289 missense probably damaging 1.00
R7951:Ckap2l UTSW 2 129285289 missense probably damaging 1.00
RF037:Ckap2l UTSW 2 129270649 small deletion probably benign
Predicted Primers PCR Primer
(F):5'- CTTTCTGTTCAGTAGCAGGGC -3'
(R):5'- AAACCTGAGAAGCCAGATCCTG -3'

Sequencing Primer
(F):5'- TCAGTAGCAGGGCATGACTCTATC -3'
(R):5'- GAGAAGCCAGATCCTGAGTTACATTC -3'
Posted On2018-04-02