Mutagenetix > Incidental Mutation

Incidental Mutation 'R6327:Ckap2l'

510459

Institutional Source

Beutler Lab

Gene Symbol

Ckap2l

Ensembl Gene

ENSMUSG00000048327

Gene Name

cytoskeleton associated protein 2-like

Synonyms

MMRRC Submission

044481-MU

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.372) question?

Stock #

R6327 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

129268210-129297212 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 129285494 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Proline at position 255 (S255P)

Ref Sequence

ENSEMBL: ENSMUSP00000056145 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000052708]

AlphaFold

Q7TS74

Predicted Effect

probably damaging
Transcript: ENSMUST00000052708
AA Change: S255P

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000056145
Gene: ENSMUSG00000048327
AA Change: S255P

Domain	Start	End	E-Value	Type
low complexity region	45	58	N/A	INTRINSIC
Pfam:CKAP2_C	425	644	3e-32	PFAM
Pfam:CKAP2_C	675	734	6.9e-18	PFAM

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.5%
20x: 98.4%

Validation Efficiency

100% (43/43)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is thought to be a mitotic spindle protein important to neural stem or progenitor cells. Mutations in this gene have been associated with spindle organization defects, including mitotic spindle defects, lagging chromosomes, and chromatin bridges. There is evidence that mutations in this gene are associated with Filippi syndrome, characterized by growth defects, microcephaly, intellectual disability, facial feature defects, and syndactyly. There is a pseudogene of this gene on chromosome 20. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2015]

Allele List at MGI

Other mutations in this stock

Total: 44 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A2ml1	T	C	6: 128,558,692		probably null	Het
Birc6	C	A	17: 74,662,779	H383Q	probably damaging	Het
C2	C	A	17: 34,864,103	A431S	probably benign	Het
C3ar1	C	T	6: 122,850,146	V371M	probably damaging	Het
Chd1l	G	A	3: 97,587,167	A399V	probably damaging	Het
Clca3a1	T	A	3: 144,730,797	I842F	probably benign	Het
Cmc2	G	T	8: 116,894,157	H28Q	probably damaging	Het
Col11a2	C	T	17: 34,043,317	P176L	probably benign	Het
Csmd3	T	C	15: 47,881,387	D1404G	probably damaging	Het
Dld	G	A	12: 31,332,191	P506S	probably benign	Het
Dsg3	T	C	18: 20,539,870	M866T	probably benign	Het
Ehd1	T	C	19: 6,298,345	I451T	possibly damaging	Het
Fosb	T	C	7: 19,307,227	T114A	probably benign	Het
Foxd4	T	A	19: 24,900,834	M1L	possibly damaging	Het
Fstl5	T	A	3: 76,707,801	I723N	probably benign	Het
Gm10549	C	A	18: 33,464,305		probably benign	Het
Gm11595	G	A	11: 99,772,555	R100C	unknown	Het
Hdlbp	A	G	1: 93,429,464	S299P	possibly damaging	Het
Mast4	G	A	13: 102,761,382	R650C	probably damaging	Het
Micu3	A	G	8: 40,366,197	T306A	probably benign	Het
Mylk2	A	G	2: 152,913,693	Q259R	possibly damaging	Het
Nfkbiz	T	C	16: 55,821,962	N31S	probably damaging	Het
Nisch	A	T	14: 31,171,487		probably benign	Het
Nudt17	T	C	3: 96,707,764		probably benign	Het
Olfr1389	A	C	11: 49,431,001	H175P	probably damaging	Het
Olfr292	T	C	7: 86,694,552	V32A	probably benign	Het
Olfr541	T	C	7: 140,704,703	W151R	probably damaging	Het
Oprm1	A	C	10: 6,830,063	I242L	probably damaging	Het
Otud6b	A	G	4: 14,826,496		probably benign	Het
Pamr1	A	T	2: 102,642,174	D606V	probably damaging	Het
Pcf11	T	C	7: 92,659,609		probably benign	Het
Pom121l2	T	C	13: 21,982,332	S258P	probably damaging	Het
Rcsd1	T	A	1: 165,655,834	D196V	possibly damaging	Het
Sbf2	C	T	7: 110,441,552	R356Q	probably damaging	Het
Serpinf1	A	G	11: 75,413,905		probably null	Het
Slc22a30	T	G	19: 8,335,722		probably benign	Het
Strn4	G	T	7: 16,816,459	S36I	probably benign	Het
Taar6	A	G	10: 23,985,279	L123P	probably damaging	Het
Thbs1	G	T	2: 118,112,656	R5L	unknown	Het
Timp3	T	C	10: 86,345,786	Y174H	probably benign	Het
Trpm2	C	T	10: 77,932,227	V813M	probably damaging	Het
Uox	C	T	3: 146,624,577	R163*	probably null	Het
Vcan	A	T	13: 89,704,832	S670T	probably damaging	Het
Vmn1r65	A	T	7: 6,008,652	N194K	possibly damaging	Het

Other mutations in Ckap2l

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01401:Ckap2l	APN	2	129269216	missense	probably damaging	1.00
IGL02120:Ckap2l	APN	2	129285622	missense	possibly damaging	0.58
IGL03085:Ckap2l	APN	2	129285047	missense	probably benign	0.00
IGL03175:Ckap2l	APN	2	129285517	missense	probably benign	0.01
IGL03333:Ckap2l	APN	2	129296308	splice site	probably null
R0196:Ckap2l	UTSW	2	129285422	missense	probably benign	0.43
R0501:Ckap2l	UTSW	2	129285491	missense	possibly damaging	0.78
R0715:Ckap2l	UTSW	2	129285716	missense	probably benign	0.02
R0834:Ckap2l	UTSW	2	129296304	splice site	probably benign
R1119:Ckap2l	UTSW	2	129272572	splice site	probably benign
R1561:Ckap2l	UTSW	2	129270725	missense	probably benign	0.01
R1677:Ckap2l	UTSW	2	129285167	missense	possibly damaging	0.86
R1823:Ckap2l	UTSW	2	129275579	missense	probably damaging	1.00
R1971:Ckap2l	UTSW	2	129285422	missense	possibly damaging	0.92
R4803:Ckap2l	UTSW	2	129269256	missense	probably damaging	1.00
R5214:Ckap2l	UTSW	2	129285469	missense	probably benign	0.02
R5264:Ckap2l	UTSW	2	129285379	missense	probably benign	0.01
R5297:Ckap2l	UTSW	2	129285370	missense	possibly damaging	0.56
R5535:Ckap2l	UTSW	2	129285842	missense	probably benign	0.00
R5606:Ckap2l	UTSW	2	129286039	missense	probably damaging	0.98
R6489:Ckap2l	UTSW	2	129269114	missense	possibly damaging	0.85
R6726:Ckap2l	UTSW	2	129269194	missense	probably damaging	1.00
R7199:Ckap2l	UTSW	2	129285055	missense	probably benign	0.25
R7220:Ckap2l	UTSW	2	129275516	missense	probably damaging	1.00
R7329:Ckap2l	UTSW	2	129285364	missense	possibly damaging	0.56
R7374:Ckap2l	UTSW	2	129284963	missense	probably damaging	1.00
R7383:Ckap2l	UTSW	2	129269252	missense	possibly damaging	0.88
R7484:Ckap2l	UTSW	2	129272535	missense	possibly damaging	0.82
R7611:Ckap2l	UTSW	2	129285680	missense	possibly damaging	0.88
R7868:Ckap2l	UTSW	2	129285289	missense	probably damaging	1.00
R8338:Ckap2l	UTSW	2	129285019	missense	probably damaging	0.99
R8514:Ckap2l	UTSW	2	129285868	missense	possibly damaging	0.61
R8790:Ckap2l	UTSW	2	129269252	missense	possibly damaging	0.88
R9043:Ckap2l	UTSW	2	129284972	missense	probably damaging	0.99
R9215:Ckap2l	UTSW	2	129281906	missense	possibly damaging	0.74
R9496:Ckap2l	UTSW	2	129270675	missense	probably benign	0.37
R9526:Ckap2l	UTSW	2	129269241	nonsense	probably null
RF037:Ckap2l	UTSW	2	129270649	small deletion	probably benign
Z1176:Ckap2l	UTSW	2	129285362	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CTTTCTGTTCAGTAGCAGGGC -3'
(R):5'- AAACCTGAGAAGCCAGATCCTG -3'

Sequencing Primer
(F):5'- TCAGTAGCAGGGCATGACTCTATC -3'
(R):5'- GAGAAGCCAGATCCTGAGTTACATTC -3'

Posted On

2018-04-02