Incidental Mutation 'R6327:Nudt17'
ID510462
Institutional Source Beutler Lab
Gene Symbol Nudt17
Ensembl Gene ENSMUSG00000028100
Gene Namenudix (nucleoside diphosphate linked moiety X)-type motif 17
Synonyms2410015C20Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.191) question?
Stock #R6327 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location96706067-96708562 bp(-) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) T to C at 96707764 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000129851 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029741] [ENSMUST00000029742] [ENSMUST00000064900] [ENSMUST00000107076] [ENSMUST00000107077] [ENSMUST00000154679] [ENSMUST00000162934] [ENSMUST00000171249] [ENSMUST00000200387]
Predicted Effect probably benign
Transcript: ENSMUST00000029741
SMART Domains Protein: ENSMUSP00000029741
Gene: ENSMUSG00000028099

DomainStartEndE-ValueType
Pfam:HTH_9 7 68 9.4e-26 PFAM
Pfam:RNA_pol_Rpc82 146 344 7.6e-46 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000029742
SMART Domains Protein: ENSMUSP00000029742
Gene: ENSMUSG00000028100

DomainStartEndE-ValueType
low complexity region 2 14 N/A INTRINSIC
Pfam:NUDIX 92 252 2.2e-9 PFAM
low complexity region 273 288 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000064900
SMART Domains Protein: ENSMUSP00000069259
Gene: ENSMUSG00000028101

DomainStartEndE-ValueType
SAP 11 45 3.75e-5 SMART
low complexity region 70 109 N/A INTRINSIC
Pfam:PINIT 126 278 1.1e-38 PFAM
Pfam:zf-MIZ 323 372 1.7e-22 PFAM
low complexity region 608 617 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000107076
SMART Domains Protein: ENSMUSP00000102691
Gene: ENSMUSG00000028101

DomainStartEndE-ValueType
SAP 2 36 3.75e-5 SMART
low complexity region 61 100 N/A INTRINSIC
Pfam:PINIT 113 269 1.1e-45 PFAM
Pfam:zf-Nse 305 361 8e-7 PFAM
Pfam:zf-MIZ 314 363 2.2e-21 PFAM
low complexity region 599 608 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000107077
SMART Domains Protein: ENSMUSP00000102692
Gene: ENSMUSG00000028101

DomainStartEndE-ValueType
SAP 11 45 3.75e-5 SMART
Pfam:PINIT 87 243 5.3e-46 PFAM
Pfam:zf-Nse 279 335 2.4e-7 PFAM
Pfam:zf-MIZ 288 337 7.4e-22 PFAM
low complexity region 573 582 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000154679
SMART Domains Protein: ENSMUSP00000122435
Gene: ENSMUSG00000028099

DomainStartEndE-ValueType
Pfam:HTH_9 7 68 1.6e-26 PFAM
Pfam:RNA_pol_Rpc82 146 344 7.6e-46 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161296
Predicted Effect probably benign
Transcript: ENSMUST00000162156
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162707
Predicted Effect probably benign
Transcript: ENSMUST00000162934
SMART Domains Protein: ENSMUSP00000125747
Gene: ENSMUSG00000028101

DomainStartEndE-ValueType
SAP 2 36 3.75e-5 SMART
low complexity region 61 100 N/A INTRINSIC
Pfam:PINIT 113 269 1.3e-46 PFAM
Pfam:zf-Nse 305 361 7e-8 PFAM
Pfam:zf-MIZ 314 363 2.6e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000171249
SMART Domains Protein: ENSMUSP00000129851
Gene: ENSMUSG00000028100

DomainStartEndE-ValueType
low complexity region 2 14 N/A INTRINSIC
Pfam:NUDIX 92 235 1.2e-18 PFAM
low complexity region 256 271 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196773
Predicted Effect unknown
Transcript: ENSMUST00000200387
AA Change: N128S
SMART Domains Protein: ENSMUSP00000142879
Gene: ENSMUSG00000028100
AA Change: N128S

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
Pfam:NUDIX 79 125 4.2e-6 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.4%
Validation Efficiency 100% (43/43)
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2ml1 T C 6: 128,558,692 probably null Het
Birc6 C A 17: 74,662,779 H383Q probably damaging Het
C2 C A 17: 34,864,103 A431S probably benign Het
C3ar1 C T 6: 122,850,146 V371M probably damaging Het
Chd1l G A 3: 97,587,167 A399V probably damaging Het
Ckap2l A G 2: 129,285,494 S255P probably damaging Het
Clca3a1 T A 3: 144,730,797 I842F probably benign Het
Cmc2 G T 8: 116,894,157 H28Q probably damaging Het
Col11a2 C T 17: 34,043,317 P176L probably benign Het
Csmd3 T C 15: 47,881,387 D1404G probably damaging Het
Dld G A 12: 31,332,191 P506S probably benign Het
Dsg3 T C 18: 20,539,870 M866T probably benign Het
Ehd1 T C 19: 6,298,345 I451T possibly damaging Het
Fosb T C 7: 19,307,227 T114A probably benign Het
Foxd4 T A 19: 24,900,834 M1L possibly damaging Het
Fstl5 T A 3: 76,707,801 I723N probably benign Het
Gm10549 C A 18: 33,464,305 probably benign Het
Gm11595 G A 11: 99,772,555 R100C unknown Het
Hdlbp A G 1: 93,429,464 S299P possibly damaging Het
Mast4 G A 13: 102,761,382 R650C probably damaging Het
Micu3 A G 8: 40,366,197 T306A probably benign Het
Mylk2 A G 2: 152,913,693 Q259R possibly damaging Het
Nfkbiz T C 16: 55,821,962 N31S probably damaging Het
Nisch A T 14: 31,171,487 probably benign Het
Olfr1389 A C 11: 49,431,001 H175P probably damaging Het
Olfr292 T C 7: 86,694,552 V32A probably benign Het
Olfr541 T C 7: 140,704,703 W151R probably damaging Het
Oprm1 A C 10: 6,830,063 I242L probably damaging Het
Otud6b A G 4: 14,826,496 probably benign Het
Pamr1 A T 2: 102,642,174 D606V probably damaging Het
Pcf11 T C 7: 92,659,609 probably benign Het
Pom121l2 T C 13: 21,982,332 S258P probably damaging Het
Rcsd1 T A 1: 165,655,834 D196V possibly damaging Het
Sbf2 C T 7: 110,441,552 R356Q probably damaging Het
Serpinf1 A G 11: 75,413,905 probably null Het
Slc22a30 T G 19: 8,335,722 probably benign Het
Strn4 G T 7: 16,816,459 S36I probably benign Het
Taar6 A G 10: 23,985,279 L123P probably damaging Het
Thbs1 G T 2: 118,112,656 R5L unknown Het
Timp3 T C 10: 86,345,786 Y174H probably benign Het
Trpm2 C T 10: 77,932,227 V813M probably damaging Het
Uox C T 3: 146,624,577 R163* probably null Het
Vcan A T 13: 89,704,832 S670T probably damaging Het
Vmn1r65 A T 7: 6,008,652 N194K possibly damaging Het
Other mutations in Nudt17
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00569:Nudt17 APN 3 96707027 missense probably damaging 1.00
IGL00705:Nudt17 APN 3 96707200 critical splice donor site probably null
IGL01945:Nudt17 APN 3 96707039 missense probably damaging 1.00
IGL02625:Nudt17 APN 3 96706464 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAACTGGTTCTTGGGCAGCTG -3'
(R):5'- ACCTACGAACAGGGTCTATGGG -3'

Sequencing Primer
(F):5'- TCTTGGGCAGCTGTAGTCCAC -3'
(R):5'- CTCCACAATGTTATTGGGCAG -3'
Posted On2018-04-02