Incidental Mutation 'R6327:Uox'
ID510465
Institutional Source Beutler Lab
Gene Symbol Uox
Ensembl Gene ENSMUSG00000028186
Gene Nameurate oxidase
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.380) question?
Stock #R6327 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location146570426-146632305 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to T at 146624577 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Stop codon at position 163 (R163*)
Ref Sequence ENSEMBL: ENSMUSP00000143418 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029837] [ENSMUST00000121133] [ENSMUST00000199489]
Predicted Effect probably null
Transcript: ENSMUST00000029837
AA Change: R187*
SMART Domains Protein: ENSMUSP00000029837
Gene: ENSMUSG00000028186
AA Change: R187*

DomainStartEndE-ValueType
Pfam:Uricase 19 144 8.7e-25 PFAM
Pfam:Uricase 153 292 5.6e-38 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000121133
AA Change: R114*
SMART Domains Protein: ENSMUSP00000113649
Gene: ENSMUSG00000028186
AA Change: R114*

DomainStartEndE-ValueType
Pfam:Uricase 2 72 1.2e-19 PFAM
Pfam:Uricase 79 181 8.5e-23 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000199489
AA Change: R163*
SMART Domains Protein: ENSMUSP00000143418
Gene: ENSMUSG00000028186
AA Change: R163*

DomainStartEndE-ValueType
Pfam:Uricase 1 121 8.3e-35 PFAM
Pfam:Uricase 128 228 1.8e-19 PFAM
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.4%
Validation Efficiency 100% (43/43)
MGI Phenotype PHENOTYPE: Homozygous null mutants exhibit marked hyperuricemia and urate nephropathy. Most mutants die prior to four weeks of age. Homozygotes for a large paracentric inversion disrupting this same gene exhibit a similar phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2ml1 T C 6: 128,558,692 probably null Het
Birc6 C A 17: 74,662,779 H383Q probably damaging Het
C2 C A 17: 34,864,103 A431S probably benign Het
C3ar1 C T 6: 122,850,146 V371M probably damaging Het
Chd1l G A 3: 97,587,167 A399V probably damaging Het
Ckap2l A G 2: 129,285,494 S255P probably damaging Het
Clca3a1 T A 3: 144,730,797 I842F probably benign Het
Cmc2 G T 8: 116,894,157 H28Q probably damaging Het
Col11a2 C T 17: 34,043,317 P176L probably benign Het
Csmd3 T C 15: 47,881,387 D1404G probably damaging Het
Dld G A 12: 31,332,191 P506S probably benign Het
Dsg3 T C 18: 20,539,870 M866T probably benign Het
Ehd1 T C 19: 6,298,345 I451T possibly damaging Het
Fosb T C 7: 19,307,227 T114A probably benign Het
Foxd4 T A 19: 24,900,834 M1L possibly damaging Het
Fstl5 T A 3: 76,707,801 I723N probably benign Het
Gm10549 C A 18: 33,464,305 probably benign Het
Gm11595 G A 11: 99,772,555 R100C unknown Het
Hdlbp A G 1: 93,429,464 S299P possibly damaging Het
Mast4 G A 13: 102,761,382 R650C probably damaging Het
Micu3 A G 8: 40,366,197 T306A probably benign Het
Mylk2 A G 2: 152,913,693 Q259R possibly damaging Het
Nfkbiz T C 16: 55,821,962 N31S probably damaging Het
Nisch A T 14: 31,171,487 probably benign Het
Nudt17 T C 3: 96,707,764 probably benign Het
Olfr1389 A C 11: 49,431,001 H175P probably damaging Het
Olfr292 T C 7: 86,694,552 V32A probably benign Het
Olfr541 T C 7: 140,704,703 W151R probably damaging Het
Oprm1 A C 10: 6,830,063 I242L probably damaging Het
Otud6b A G 4: 14,826,496 probably benign Het
Pamr1 A T 2: 102,642,174 D606V probably damaging Het
Pcf11 T C 7: 92,659,609 probably benign Het
Pom121l2 T C 13: 21,982,332 S258P probably damaging Het
Rcsd1 T A 1: 165,655,834 D196V possibly damaging Het
Sbf2 C T 7: 110,441,552 R356Q probably damaging Het
Serpinf1 A G 11: 75,413,905 probably null Het
Slc22a30 T G 19: 8,335,722 probably benign Het
Strn4 G T 7: 16,816,459 S36I probably benign Het
Taar6 A G 10: 23,985,279 L123P probably damaging Het
Thbs1 G T 2: 118,112,656 R5L unknown Het
Timp3 T C 10: 86,345,786 Y174H probably benign Het
Trpm2 C T 10: 77,932,227 V813M probably damaging Het
Vcan A T 13: 89,704,832 S670T probably damaging Het
Vmn1r65 A T 7: 6,008,652 N194K possibly damaging Het
Other mutations in Uox
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00417:Uox APN 3 146627810 missense probably benign 0.00
IGL00902:Uox APN 3 146610406 missense possibly damaging 0.95
IGL02409:Uox APN 3 146624626 missense probably benign 0.06
IGL02827:Uox APN 3 146597196 intron probably benign
IGL02979:Uox APN 3 146610491 splice site probably null
IGL03375:Uox APN 3 146625835 missense probably damaging 1.00
kamloops UTSW 3 146624577 nonsense probably null
R1350:Uox UTSW 3 146624575 missense probably damaging 1.00
R1634:Uox UTSW 3 146612383 nonsense probably null
R1900:Uox UTSW 3 146610379 missense probably damaging 1.00
R2000:Uox UTSW 3 146610399 missense possibly damaging 0.65
R2119:Uox UTSW 3 146612542 missense probably benign 0.01
R5329:Uox UTSW 3 146624545 missense probably damaging 1.00
R5606:Uox UTSW 3 146610302 nonsense probably null
R6281:Uox UTSW 3 146624577 nonsense probably null
R6337:Uox UTSW 3 146624577 nonsense probably null
R6364:Uox UTSW 3 146624577 nonsense probably null
R6365:Uox UTSW 3 146624577 nonsense probably null
R6369:Uox UTSW 3 146624577 nonsense probably null
R6483:Uox UTSW 3 146624577 nonsense probably null
R6492:Uox UTSW 3 146624577 nonsense probably null
R6494:Uox UTSW 3 146624577 nonsense probably null
R6556:Uox UTSW 3 146624648 critical splice donor site probably null
R6803:Uox UTSW 3 146612509 missense possibly damaging 0.91
R7809:Uox UTSW 3 146627858 nonsense probably null
R7868:Uox UTSW 3 146610274 missense probably benign 0.01
R7951:Uox UTSW 3 146610274 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GTCTGGCAATCCATAGAGAAGG -3'
(R):5'- CAGTCCCAAAGAACTAGGAATTTGAG -3'

Sequencing Primer
(F):5'- TCCATAGAGAAGGGACGCCC -3'
(R):5'- AGGAATTTGAGTTGACAGTTTCCTC -3'
Posted On2018-04-02