Incidental Mutation 'R6327:C3ar1'
ID510467
Institutional Source Beutler Lab
Gene Symbol C3ar1
Ensembl Gene ENSMUSG00000040552
Gene Namecomplement component 3a receptor 1
SynonymsC3aR, anaphylatoxin C3a receptor
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6327 (G1)
Quality Score225.009
Status Validated
Chromosome6
Chromosomal Location122847138-122856161 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 122850146 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 371 (V371M)
Ref Sequence ENSEMBL: ENSMUSP00000048092 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003238] [ENSMUST00000042081] [ENSMUST00000177927]
Predicted Effect probably benign
Transcript: ENSMUST00000003238
SMART Domains Protein: ENSMUSP00000003238
Gene: ENSMUSG00000003154

DomainStartEndE-ValueType
low complexity region 28 39 N/A INTRINSIC
FH 64 153 1.77e-47 SMART
low complexity region 207 222 N/A INTRINSIC
low complexity region 266 275 N/A INTRINSIC
low complexity region 290 314 N/A INTRINSIC
low complexity region 359 393 N/A INTRINSIC
low complexity region 535 549 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000042081
AA Change: V371M

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000048092
Gene: ENSMUSG00000040552
AA Change: V371M

DomainStartEndE-ValueType
Pfam:7tm_1 40 193 8.1e-25 PFAM
Pfam:7TM_GPCR_Srsx 281 443 7.8e-8 PFAM
Pfam:7tm_1 313 428 6.5e-17 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000177927
SMART Domains Protein: ENSMUSP00000137645
Gene: ENSMUSG00000003154

DomainStartEndE-ValueType
low complexity region 28 39 N/A INTRINSIC
FH 64 153 1.77e-47 SMART
low complexity region 207 222 N/A INTRINSIC
low complexity region 266 275 N/A INTRINSIC
low complexity region 290 314 N/A INTRINSIC
low complexity region 359 393 N/A INTRINSIC
low complexity region 535 549 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.4%
Validation Efficiency 100% (43/43)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] C3a is an anaphylatoxin released during activation of the complement system. The protein encoded by this gene is an orphan G protein-coupled receptor for C3a. Binding of C3a by the encoded receptor activates chemotaxis, granule enzyme release, superoxide anion production, and bacterial opsonization. [provided by RefSeq, May 2016]
PHENOTYPE: Homozygous targeted mutants display protective effects against the changes in lung physiology after allergen challenge, increased lethality to endotoxin shock, and elevated IL1B following LPS challenge, supporting the role of C3arin proinflammatory responses. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2ml1 T C 6: 128,558,692 probably null Het
Birc6 C A 17: 74,662,779 H383Q probably damaging Het
C2 C A 17: 34,864,103 A431S probably benign Het
Chd1l G A 3: 97,587,167 A399V probably damaging Het
Ckap2l A G 2: 129,285,494 S255P probably damaging Het
Clca3a1 T A 3: 144,730,797 I842F probably benign Het
Cmc2 G T 8: 116,894,157 H28Q probably damaging Het
Col11a2 C T 17: 34,043,317 P176L probably benign Het
Csmd3 T C 15: 47,881,387 D1404G probably damaging Het
Dld G A 12: 31,332,191 P506S probably benign Het
Dsg3 T C 18: 20,539,870 M866T probably benign Het
Ehd1 T C 19: 6,298,345 I451T possibly damaging Het
Fosb T C 7: 19,307,227 T114A probably benign Het
Foxd4 T A 19: 24,900,834 M1L possibly damaging Het
Fstl5 T A 3: 76,707,801 I723N probably benign Het
Gm10549 C A 18: 33,464,305 probably benign Het
Gm11595 G A 11: 99,772,555 R100C unknown Het
Hdlbp A G 1: 93,429,464 S299P possibly damaging Het
Mast4 G A 13: 102,761,382 R650C probably damaging Het
Micu3 A G 8: 40,366,197 T306A probably benign Het
Mylk2 A G 2: 152,913,693 Q259R possibly damaging Het
Nfkbiz T C 16: 55,821,962 N31S probably damaging Het
Nisch A T 14: 31,171,487 probably benign Het
Nudt17 T C 3: 96,707,764 probably benign Het
Olfr1389 A C 11: 49,431,001 H175P probably damaging Het
Olfr292 T C 7: 86,694,552 V32A probably benign Het
Olfr541 T C 7: 140,704,703 W151R probably damaging Het
Oprm1 A C 10: 6,830,063 I242L probably damaging Het
Otud6b A G 4: 14,826,496 probably benign Het
Pamr1 A T 2: 102,642,174 D606V probably damaging Het
Pcf11 T C 7: 92,659,609 probably benign Het
Pom121l2 T C 13: 21,982,332 S258P probably damaging Het
Rcsd1 T A 1: 165,655,834 D196V possibly damaging Het
Sbf2 C T 7: 110,441,552 R356Q probably damaging Het
Serpinf1 A G 11: 75,413,905 probably null Het
Slc22a30 T G 19: 8,335,722 probably benign Het
Strn4 G T 7: 16,816,459 S36I probably benign Het
Taar6 A G 10: 23,985,279 L123P probably damaging Het
Thbs1 G T 2: 118,112,656 R5L unknown Het
Timp3 T C 10: 86,345,786 Y174H probably benign Het
Trpm2 C T 10: 77,932,227 V813M probably damaging Het
Uox C T 3: 146,624,577 R163* probably null Het
Vcan A T 13: 89,704,832 S670T probably damaging Het
Vmn1r65 A T 7: 6,008,652 N194K possibly damaging Het
Other mutations in C3ar1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01818:C3ar1 APN 6 122850419 missense probably benign 0.00
IGL01936:C3ar1 APN 6 122851235 missense probably benign 0.04
IGL01998:C3ar1 APN 6 122850940 missense probably damaging 1.00
IGL02351:C3ar1 APN 6 122849975 missense probably damaging 1.00
IGL02358:C3ar1 APN 6 122849975 missense probably damaging 1.00
IGL02399:C3ar1 APN 6 122849879 missense probably benign 0.00
PIT4618001:C3ar1 UTSW 6 122850787 missense probably benign 0.25
R0014:C3ar1 UTSW 6 122850851 missense probably damaging 1.00
R0195:C3ar1 UTSW 6 122851155 missense possibly damaging 0.95
R0257:C3ar1 UTSW 6 122850787 missense probably benign 0.25
R0344:C3ar1 UTSW 6 122850772 missense probably benign 0.45
R4345:C3ar1 UTSW 6 122850700 missense probably damaging 1.00
R4614:C3ar1 UTSW 6 122850721 missense probably benign 0.00
R4643:C3ar1 UTSW 6 122850974 missense probably damaging 1.00
R4840:C3ar1 UTSW 6 122850764 missense probably benign
R5235:C3ar1 UTSW 6 122850922 missense probably damaging 1.00
R5303:C3ar1 UTSW 6 122849835 missense probably damaging 1.00
R5610:C3ar1 UTSW 6 122850578 missense probably benign 0.01
R5762:C3ar1 UTSW 6 122850362 missense probably benign 0.07
R5873:C3ar1 UTSW 6 122850422 missense probably benign 0.24
R5877:C3ar1 UTSW 6 122850622 missense probably benign 0.17
R6440:C3ar1 UTSW 6 122850508 missense probably damaging 0.99
R6505:C3ar1 UTSW 6 122850640 missense probably benign 0.03
R6636:C3ar1 UTSW 6 122851054 missense probably damaging 1.00
R6755:C3ar1 UTSW 6 122849858 missense probably benign 0.00
R6953:C3ar1 UTSW 6 122850632 missense possibly damaging 0.49
R8049:C3ar1 UTSW 6 122850100 missense probably damaging 0.97
X0065:C3ar1 UTSW 6 122850765 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GAAGGCTGCTTCCAGAATGC -3'
(R):5'- GGGGATTATGTTGACCAATTCACG -3'

Sequencing Primer
(F):5'- TCCTAAAGTCTTTCCCCAAGAGG -3'
(R):5'- CGTATGACAATCATGTGCCG -3'
Posted On2018-04-02