Incidental Mutation 'R6327:Strn4'
ID510469
Institutional Source Beutler Lab
Gene Symbol Strn4
Ensembl Gene ENSMUSG00000030374
Gene Namestriatin, calmodulin binding protein 4
SynonymsZIN, zinedin
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.809) question?
Stock #R6327 (G1)
Quality Score94.0077
Status Validated
Chromosome7
Chromosomal Location16815889-16840931 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 16816459 bp
ZygosityHeterozygous
Amino Acid Change Serine to Isoleucine at position 36 (S36I)
Ref Sequence ENSEMBL: ENSMUSP00000104135 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019220] [ENSMUST00000061390] [ENSMUST00000108495] [ENSMUST00000206259]
Predicted Effect probably benign
Transcript: ENSMUST00000019220
AA Change: S36I

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000019220
Gene: ENSMUSG00000030374
AA Change: S36I

DomainStartEndE-ValueType
low complexity region 6 16 N/A INTRINSIC
low complexity region 21 60 N/A INTRINSIC
Pfam:Striatin 64 193 1.2e-44 PFAM
low complexity region 217 236 N/A INTRINSIC
low complexity region 272 284 N/A INTRINSIC
low complexity region 304 314 N/A INTRINSIC
low complexity region 367 382 N/A INTRINSIC
low complexity region 416 429 N/A INTRINSIC
WD40 434 473 5.72e-9 SMART
WD40 487 526 6.53e-4 SMART
WD40 540 579 6.99e-13 SMART
WD40 584 626 2.38e1 SMART
WD40 629 672 3.55e1 SMART
WD40 675 714 5.34e-9 SMART
WD40 717 760 1.58e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000061390
SMART Domains Protein: ENSMUSP00000059091
Gene: ENSMUSG00000048920

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
low complexity region 258 276 N/A INTRINSIC
Pfam:LicD 334 374 1.5e-15 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000108495
AA Change: S36I

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000104135
Gene: ENSMUSG00000030374
AA Change: S36I

DomainStartEndE-ValueType
low complexity region 6 16 N/A INTRINSIC
low complexity region 21 60 N/A INTRINSIC
Pfam:Striatin 64 197 1.4e-45 PFAM
low complexity region 217 236 N/A INTRINSIC
low complexity region 272 284 N/A INTRINSIC
low complexity region 304 314 N/A INTRINSIC
low complexity region 367 382 N/A INTRINSIC
low complexity region 409 422 N/A INTRINSIC
WD40 427 466 5.72e-9 SMART
WD40 480 519 6.53e-4 SMART
WD40 533 572 6.99e-13 SMART
WD40 577 619 2.38e1 SMART
WD40 622 665 3.55e1 SMART
WD40 668 707 5.34e-9 SMART
WD40 710 753 1.58e-2 SMART
Predicted Effect unknown
Transcript: ENSMUST00000184280
AA Change: S27I
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205368
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205677
Predicted Effect probably benign
Transcript: ENSMUST00000206259
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.4%
Validation Efficiency 100% (43/43)
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2ml1 T C 6: 128,558,692 probably null Het
Birc6 C A 17: 74,662,779 H383Q probably damaging Het
C2 C A 17: 34,864,103 A431S probably benign Het
C3ar1 C T 6: 122,850,146 V371M probably damaging Het
Chd1l G A 3: 97,587,167 A399V probably damaging Het
Ckap2l A G 2: 129,285,494 S255P probably damaging Het
Clca3a1 T A 3: 144,730,797 I842F probably benign Het
Cmc2 G T 8: 116,894,157 H28Q probably damaging Het
Col11a2 C T 17: 34,043,317 P176L probably benign Het
Csmd3 T C 15: 47,881,387 D1404G probably damaging Het
Dld G A 12: 31,332,191 P506S probably benign Het
Dsg3 T C 18: 20,539,870 M866T probably benign Het
Ehd1 T C 19: 6,298,345 I451T possibly damaging Het
Fosb T C 7: 19,307,227 T114A probably benign Het
Foxd4 T A 19: 24,900,834 M1L possibly damaging Het
Fstl5 T A 3: 76,707,801 I723N probably benign Het
Gm10549 C A 18: 33,464,305 probably benign Het
Gm11595 G A 11: 99,772,555 R100C unknown Het
Hdlbp A G 1: 93,429,464 S299P possibly damaging Het
Mast4 G A 13: 102,761,382 R650C probably damaging Het
Micu3 A G 8: 40,366,197 T306A probably benign Het
Mylk2 A G 2: 152,913,693 Q259R possibly damaging Het
Nfkbiz T C 16: 55,821,962 N31S probably damaging Het
Nisch A T 14: 31,171,487 probably benign Het
Nudt17 T C 3: 96,707,764 probably benign Het
Olfr1389 A C 11: 49,431,001 H175P probably damaging Het
Olfr292 T C 7: 86,694,552 V32A probably benign Het
Olfr541 T C 7: 140,704,703 W151R probably damaging Het
Oprm1 A C 10: 6,830,063 I242L probably damaging Het
Otud6b A G 4: 14,826,496 probably benign Het
Pamr1 A T 2: 102,642,174 D606V probably damaging Het
Pcf11 T C 7: 92,659,609 probably benign Het
Pom121l2 T C 13: 21,982,332 S258P probably damaging Het
Rcsd1 T A 1: 165,655,834 D196V possibly damaging Het
Sbf2 C T 7: 110,441,552 R356Q probably damaging Het
Serpinf1 A G 11: 75,413,905 probably null Het
Slc22a30 T G 19: 8,335,722 probably benign Het
Taar6 A G 10: 23,985,279 L123P probably damaging Het
Thbs1 G T 2: 118,112,656 R5L unknown Het
Timp3 T C 10: 86,345,786 Y174H probably benign Het
Trpm2 C T 10: 77,932,227 V813M probably damaging Het
Uox C T 3: 146,624,577 R163* probably null Het
Vcan A T 13: 89,704,832 S670T probably damaging Het
Vmn1r65 A T 7: 6,008,652 N194K possibly damaging Het
Other mutations in Strn4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00776:Strn4 APN 7 16830452 missense probably damaging 1.00
IGL01153:Strn4 APN 7 16837921 missense probably damaging 1.00
IGL01748:Strn4 APN 7 16838302 missense probably damaging 1.00
IGL03227:Strn4 APN 7 16837714 missense possibly damaging 0.79
PIT4260001:Strn4 UTSW 7 16822509 missense probably damaging 1.00
R0948:Strn4 UTSW 7 16837713 nonsense probably null
R1876:Strn4 UTSW 7 16838282 missense probably damaging 1.00
R1918:Strn4 UTSW 7 16833921 missense probably damaging 1.00
R2015:Strn4 UTSW 7 16833028 missense possibly damaging 0.85
R2250:Strn4 UTSW 7 16826466 missense probably damaging 1.00
R3435:Strn4 UTSW 7 16837633 missense possibly damaging 0.86
R3686:Strn4 UTSW 7 16822581 missense probably damaging 1.00
R3688:Strn4 UTSW 7 16822581 missense probably damaging 1.00
R3887:Strn4 UTSW 7 16822998 unclassified probably benign
R4613:Strn4 UTSW 7 16824163 missense possibly damaging 0.50
R4730:Strn4 UTSW 7 16828794 missense possibly damaging 0.59
R5590:Strn4 UTSW 7 16833874 critical splice acceptor site probably null
R5924:Strn4 UTSW 7 16838321 missense probably damaging 1.00
R6759:Strn4 UTSW 7 16823053 missense probably damaging 1.00
R6866:Strn4 UTSW 7 16828785 missense probably damaging 0.97
R6976:Strn4 UTSW 7 16830354 missense probably benign 0.20
R7759:Strn4 UTSW 7 16830384 missense probably damaging 1.00
R7779:Strn4 UTSW 7 16831492 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TAGAAGTGTGAAGCTGCGC -3'
(R):5'- TTATTCGCGCAGACCCCATC -3'

Sequencing Primer
(F):5'- GTGAAGCTGCGCGTCCG -3'
(R):5'- ATTGCTCCAAGATGGCGG -3'
Posted On2018-04-02