Incidental Mutation 'R6327:Oprm1'
ID510477
Institutional Source Beutler Lab
Gene Symbol Oprm1
Ensembl Gene ENSMUSG00000000766
Gene Nameopioid receptor, mu 1
SynonymsOprm, MOP receptor, mor, muOR, MOR-1, MOP-R
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.109) question?
Stock #R6327 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location6758506-7038198 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 6830063 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Leucine at position 242 (I242L)
Ref Sequence ENSEMBL: ENSMUSP00000101229 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000783] [ENSMUST00000052751] [ENSMUST00000056385] [ENSMUST00000063036] [ENSMUST00000078634] [ENSMUST00000092729] [ENSMUST00000092731] [ENSMUST00000092734] [ENSMUST00000105597] [ENSMUST00000105601] [ENSMUST00000105602] [ENSMUST00000105603] [ENSMUST00000105604] [ENSMUST00000105605] [ENSMUST00000105607] [ENSMUST00000105611] [ENSMUST00000105615] [ENSMUST00000123861] [ENSMUST00000129221] [ENSMUST00000129954] [ENSMUST00000135502] [ENSMUST00000143875] [ENSMUST00000144264] [ENSMUST00000147171] [ENSMUST00000150374] [ENSMUST00000152674] [ENSMUST00000154906] [ENSMUST00000154941]
Predicted Effect probably benign
Transcript: ENSMUST00000000783
AA Change: I242L

PolyPhen 2 Score 0.212 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000000783
Gene: ENSMUSG00000000766
AA Change: I242L

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srx 76 339 1.6e-7 PFAM
Pfam:7TM_GPCR_Srsx 79 351 1.3e-10 PFAM
Pfam:7tm_1 85 336 4e-67 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000052751
AA Change: I242L

PolyPhen 2 Score 0.212 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000060329
Gene: ENSMUSG00000000766
AA Change: I242L

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srx 76 325 1.1e-7 PFAM
Pfam:7TM_GPCR_Srsx 79 351 1e-10 PFAM
Pfam:7tm_1 85 336 3.2e-67 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000056385
AA Change: I242L

PolyPhen 2 Score 0.212 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000060590
Gene: ENSMUSG00000000766
AA Change: I242L

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srx 76 325 1.7e-7 PFAM
Pfam:7TM_GPCR_Srsx 79 351 1e-10 PFAM
Pfam:7tm_1 85 336 3.3e-67 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000063036
AA Change: I174L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000053498
Gene: ENSMUSG00000000766
AA Change: I174L

DomainStartEndE-ValueType
Pfam:7tm_1 24 268 8.7e-64 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000078634
AA Change: I242L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000077704
Gene: ENSMUSG00000000766
AA Change: I242L

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srx 76 339 2.1e-7 PFAM
Pfam:7TM_GPCR_Srsx 79 351 2.4e-10 PFAM
Pfam:7tm_1 85 336 9e-60 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000092729
AA Change: I242L

PolyPhen 2 Score 0.212 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000090405
Gene: ENSMUSG00000000766
AA Change: I242L

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srx 76 325 1.7e-7 PFAM
Pfam:7TM_GPCR_Srsx 79 351 9.6e-11 PFAM
Pfam:7tm_1 85 336 3.1e-67 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000092731
AA Change: I242L

PolyPhen 2 Score 0.212 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000090407
Gene: ENSMUSG00000000766
AA Change: I242L

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srx 76 325 1e-7 PFAM
Pfam:7TM_GPCR_Srsx 79 351 9.9e-11 PFAM
Pfam:7tm_1 85 336 3.2e-67 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000092734
AA Change: I242L

PolyPhen 2 Score 0.212 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000090410
Gene: ENSMUSG00000000766
AA Change: I242L

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srx 76 325 1.7e-7 PFAM
Pfam:7TM_GPCR_Srsx 79 351 1e-10 PFAM
Pfam:7tm_1 85 336 3.3e-67 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000105597
Predicted Effect possibly damaging
Transcript: ENSMUST00000105601
AA Change: H124P

PolyPhen 2 Score 0.827 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000101226
Gene: ENSMUSG00000000766
AA Change: H124P

DomainStartEndE-ValueType
SCOP:d1l9ha_ 46 100 3e-9 SMART
PDB:4DKL|A 52 100 3e-21 PDB
low complexity region 119 131 N/A INTRINSIC
low complexity region 173 184 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000105602
AA Change: I242L

PolyPhen 2 Score 0.212 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000101227
Gene: ENSMUSG00000000766
AA Change: I242L

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srx 76 325 1.8e-7 PFAM
Pfam:7TM_GPCR_Srsx 79 351 9.8e-11 PFAM
Pfam:7tm_1 85 336 3.1e-67 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000105603
AA Change: I242L

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000101228
Gene: ENSMUSG00000000766
AA Change: I242L

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srx 76 325 6.7e-8 PFAM
Pfam:7TM_GPCR_Srsx 79 351 9.6e-11 PFAM
Pfam:7tm_1 85 336 3.6e-67 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000105604
AA Change: I242L

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000101229
Gene: ENSMUSG00000000766
AA Change: I242L

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srx 76 332 5.1e-8 PFAM
Pfam:7TM_GPCR_Srsx 79 351 9.9e-11 PFAM
Pfam:7tm_1 85 336 3.8e-67 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000105605
AA Change: I242L

PolyPhen 2 Score 0.212 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000101230
Gene: ENSMUSG00000000766
AA Change: I242L

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srx 76 325 1e-7 PFAM
Pfam:7TM_GPCR_Srsx 79 351 9.8e-11 PFAM
Pfam:7tm_1 85 336 3.2e-67 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000105607
AA Change: I242L

PolyPhen 2 Score 0.212 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000101232
Gene: ENSMUSG00000000766
AA Change: I242L

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srx 76 325 1.7e-7 PFAM
Pfam:7TM_GPCR_Srsx 79 351 1e-10 PFAM
Pfam:7tm_1 85 336 3.3e-67 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000105611
AA Change: I242L

PolyPhen 2 Score 0.212 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000101236
Gene: ENSMUSG00000000766
AA Change: I242L

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srx 76 338 1.7e-7 PFAM
Pfam:7TM_GPCR_Srsx 79 351 1.4e-10 PFAM
Pfam:7tm_1 85 336 4.4e-67 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000105615
AA Change: I174L

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000101240
Gene: ENSMUSG00000000766
AA Change: I174L

DomainStartEndE-ValueType
Pfam:7tm_1 24 268 1.3e-63 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000123861
AA Change: H124P

PolyPhen 2 Score 0.974 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000120187
Gene: ENSMUSG00000000766
AA Change: H124P

DomainStartEndE-ValueType
SCOP:d1l9ha_ 46 100 3e-9 SMART
PDB:4DKL|A 52 100 3e-21 PDB
low complexity region 119 131 N/A INTRINSIC
low complexity region 173 184 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000129221
AA Change: I178L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000123117
Gene: ENSMUSG00000000766
AA Change: I178L

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srx 12 261 1.1e-7 PFAM
Pfam:7TM_GPCR_Srsx 15 287 7.3e-11 PFAM
Pfam:7tm_1 21 272 2.4e-67 PFAM
low complexity region 340 351 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000129954
AA Change: I242L

PolyPhen 2 Score 0.955 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000122385
Gene: ENSMUSG00000000766
AA Change: I242L

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srx 76 338 6.9e-8 PFAM
Pfam:7TM_GPCR_Srsx 79 351 1.5e-10 PFAM
Pfam:7tm_1 85 336 5.4e-67 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133486
Predicted Effect probably benign
Transcript: ENSMUST00000135502
AA Change: I242L

PolyPhen 2 Score 0.212 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000135143
Gene: ENSMUSG00000000766
AA Change: I242L

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srx 76 339 2.2e-7 PFAM
Pfam:7TM_GPCR_Srsx 79 351 1.9e-10 PFAM
Pfam:7tm_1 85 336 7.5e-67 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141897
Predicted Effect probably benign
Transcript: ENSMUST00000143875
Predicted Effect probably benign
Transcript: ENSMUST00000144264
AA Change: I242L

PolyPhen 2 Score 0.212 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000115836
Gene: ENSMUSG00000000766
AA Change: I242L

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srx 76 325 1.7e-7 PFAM
Pfam:7TM_GPCR_Srsx 79 351 1e-10 PFAM
Pfam:7tm_1 85 336 3.4e-67 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000147171
AA Change: I174L

PolyPhen 2 Score 0.447 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000117950
Gene: ENSMUSG00000000766
AA Change: I174L

DomainStartEndE-ValueType
Pfam:7tm_1 24 268 9.2e-64 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148625
Predicted Effect probably benign
Transcript: ENSMUST00000150374
Predicted Effect probably benign
Transcript: ENSMUST00000152674
SMART Domains Protein: ENSMUSP00000115552
Gene: ENSMUSG00000000766

DomainStartEndE-ValueType
SCOP:d1l9ha_ 46 94 8e-8 SMART
PDB:4DKL|A 52 94 7e-23 PDB
Predicted Effect possibly damaging
Transcript: ENSMUST00000154906
AA Change: I242L

PolyPhen 2 Score 0.944 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000114342
Gene: ENSMUSG00000000766
AA Change: I242L

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srx 76 332 1.5e-7 PFAM
Pfam:7TM_GPCR_Srsx 79 351 1.1e-10 PFAM
Pfam:7tm_1 85 336 3.6e-67 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000154941
AA Change: I178L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000115413
Gene: ENSMUSG00000000766
AA Change: I178L

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srx 12 261 9.6e-8 PFAM
Pfam:7TM_GPCR_Srsx 15 287 6.1e-11 PFAM
Pfam:7tm_1 21 272 2e-67 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.4%
Validation Efficiency 100% (43/43)
MGI Phenotype FUNCTION: This gene encodes the mu opioid receptor which is where drugs such as morphine and other opioids have pharmacological effects. Several alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2014]
PHENOTYPE: Homozygotes for null mutations exhibit isoform dependent loss of behavioral and gastrointestinal opioid responses and may also show impaired spatial memory, heightened nociception, reduced locomotor activity, increased hematopoietic proliferation, and decreased male fertility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2ml1 T C 6: 128,558,692 probably null Het
Birc6 C A 17: 74,662,779 H383Q probably damaging Het
C2 C A 17: 34,864,103 A431S probably benign Het
C3ar1 C T 6: 122,850,146 V371M probably damaging Het
Chd1l G A 3: 97,587,167 A399V probably damaging Het
Ckap2l A G 2: 129,285,494 S255P probably damaging Het
Clca3a1 T A 3: 144,730,797 I842F probably benign Het
Cmc2 G T 8: 116,894,157 H28Q probably damaging Het
Col11a2 C T 17: 34,043,317 P176L probably benign Het
Csmd3 T C 15: 47,881,387 D1404G probably damaging Het
Dld G A 12: 31,332,191 P506S probably benign Het
Dsg3 T C 18: 20,539,870 M866T probably benign Het
Ehd1 T C 19: 6,298,345 I451T possibly damaging Het
Fosb T C 7: 19,307,227 T114A probably benign Het
Foxd4 T A 19: 24,900,834 M1L possibly damaging Het
Fstl5 T A 3: 76,707,801 I723N probably benign Het
Gm10549 C A 18: 33,464,305 probably benign Het
Gm11595 G A 11: 99,772,555 R100C unknown Het
Hdlbp A G 1: 93,429,464 S299P possibly damaging Het
Mast4 G A 13: 102,761,382 R650C probably damaging Het
Micu3 A G 8: 40,366,197 T306A probably benign Het
Mylk2 A G 2: 152,913,693 Q259R possibly damaging Het
Nfkbiz T C 16: 55,821,962 N31S probably damaging Het
Nisch A T 14: 31,171,487 probably benign Het
Nudt17 T C 3: 96,707,764 probably benign Het
Olfr1389 A C 11: 49,431,001 H175P probably damaging Het
Olfr292 T C 7: 86,694,552 V32A probably benign Het
Olfr541 T C 7: 140,704,703 W151R probably damaging Het
Otud6b A G 4: 14,826,496 probably benign Het
Pamr1 A T 2: 102,642,174 D606V probably damaging Het
Pcf11 T C 7: 92,659,609 probably benign Het
Pom121l2 T C 13: 21,982,332 S258P probably damaging Het
Rcsd1 T A 1: 165,655,834 D196V possibly damaging Het
Sbf2 C T 7: 110,441,552 R356Q probably damaging Het
Serpinf1 A G 11: 75,413,905 probably null Het
Slc22a30 T G 19: 8,335,722 probably benign Het
Strn4 G T 7: 16,816,459 S36I probably benign Het
Taar6 A G 10: 23,985,279 L123P probably damaging Het
Thbs1 G T 2: 118,112,656 R5L unknown Het
Timp3 T C 10: 86,345,786 Y174H probably benign Het
Trpm2 C T 10: 77,932,227 V813M probably damaging Het
Uox C T 3: 146,624,577 R163* probably null Het
Vcan A T 13: 89,704,832 S670T probably damaging Het
Vmn1r65 A T 7: 6,008,652 N194K possibly damaging Het
Other mutations in Oprm1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01018:Oprm1 APN 10 7037170 utr 3 prime probably benign
IGL01768:Oprm1 APN 10 6829186 missense probably damaging 1.00
IGL02455:Oprm1 APN 10 6830219 missense probably damaging 1.00
IGL03391:Oprm1 APN 10 7014077 intron probably benign
IGL03410:Oprm1 APN 10 6830051 missense probably damaging 1.00
IGL03048:Oprm1 UTSW 10 6829064 missense probably damaging 1.00
R0189:Oprm1 UTSW 10 6789071 missense possibly damaging 0.94
R0321:Oprm1 UTSW 10 6829183 missense probably damaging 1.00
R0629:Oprm1 UTSW 10 6832604 unclassified probably null
R0730:Oprm1 UTSW 10 6832652 intron probably benign
R1542:Oprm1 UTSW 10 6788960 missense probably damaging 1.00
R1743:Oprm1 UTSW 10 6830105 missense probably damaging 0.99
R1874:Oprm1 UTSW 10 6789035 missense probably benign 0.17
R2864:Oprm1 UTSW 10 6794226 splice site probably null
R2964:Oprm1 UTSW 10 6788914 missense probably damaging 0.98
R3792:Oprm1 UTSW 10 6839544 missense probably benign 0.00
R4008:Oprm1 UTSW 10 6832520 missense probably benign
R4049:Oprm1 UTSW 10 6829087 missense probably benign 0.36
R4088:Oprm1 UTSW 10 6830234 missense probably damaging 1.00
R4724:Oprm1 UTSW 10 6758656 nonsense probably null
R4812:Oprm1 UTSW 10 6832698 intron probably benign
R4822:Oprm1 UTSW 10 6829036 missense probably damaging 0.99
R4855:Oprm1 UTSW 10 6838468 missense probably benign 0.01
R5072:Oprm1 UTSW 10 6832550 missense probably benign 0.15
R5768:Oprm1 UTSW 10 6789026 missense probably damaging 1.00
R5770:Oprm1 UTSW 10 6789026 missense probably damaging 1.00
R5995:Oprm1 UTSW 10 6832520 missense probably benign
R7135:Oprm1 UTSW 10 6830203 missense possibly damaging 0.77
R7413:Oprm1 UTSW 10 6828919 missense probably damaging 1.00
R7455:Oprm1 UTSW 10 6830204 missense probably damaging 1.00
X0066:Oprm1 UTSW 10 6830462 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TCTGTAAGCAACAACCTAGGC -3'
(R):5'- AGTGCCAGGAAACAGTCTGG -3'

Sequencing Primer
(F):5'- CTGTAAGCAACAACCTAGGCAAAGG -3'
(R):5'- AAACAGTCTGGAAAGTGGTTTCTG -3'
Posted On2018-04-02