Incidental Mutation 'R6327:Trpm2'
ID 510479
Institutional Source Beutler Lab
Gene Symbol Trpm2
Ensembl Gene ENSMUSG00000009292
Gene Name transient receptor potential cation channel, subfamily M, member 2
Synonyms Trrp7, TRPC7, LTRPC2, 9830168K16Rik
MMRRC Submission 044481-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.200) question?
Stock # R6327 (G1)
Quality Score 225.009
Status Validated
Chromosome 10
Chromosomal Location 77743556-77805746 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 77768061 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Methionine at position 813 (V813M)
Ref Sequence ENSEMBL: ENSMUSP00000101040 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000105401]
AlphaFold Q91YD4
Predicted Effect noncoding transcript
Transcript: ENSMUST00000105400
Predicted Effect probably damaging
Transcript: ENSMUST00000105401
AA Change: V813M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000101040
Gene: ENSMUSG00000009292
AA Change: V813M

DomainStartEndE-ValueType
low complexity region 654 672 N/A INTRINSIC
transmembrane domain 750 772 N/A INTRINSIC
Pfam:Ion_trans 794 1057 3.7e-21 PFAM
low complexity region 1078 1090 N/A INTRINSIC
low complexity region 1106 1115 N/A INTRINSIC
low complexity region 1123 1146 N/A INTRINSIC
PDB:1QVJ|A 1236 1506 3e-37 PDB
SCOP:d1k2ea_ 1369 1502 9e-10 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126206
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140471
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153842
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.4%
Validation Efficiency 100% (43/43)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene forms a tetrameric cation channel that is permeable to calcium, sodium, and potassium and is regulated by free intracellular ADP-ribose. The encoded protein is activated by oxidative stress and confers susceptibility to cell death. Alternative splicing results in multiple transcript variants encoding distinct protein isoforms. Additional transcript variants of this gene have been described, but their full-length nature is not known. [provided by RefSeq, Feb 2016]
PHENOTYPE: Mice homozygous for a knock-out allele display impaired reactive oxygen species (ROS)-induced chemokine production in monocytes, and reduced neutrophil infiltration and ulceration in a dextran sulfate sodium-induced colitis inflammation model. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2ml1 T C 6: 128,535,655 (GRCm39) probably null Het
Birc6 C A 17: 74,969,774 (GRCm39) H383Q probably damaging Het
C2 C A 17: 35,083,079 (GRCm39) A431S probably benign Het
C3ar1 C T 6: 122,827,105 (GRCm39) V371M probably damaging Het
Chd1l G A 3: 97,494,483 (GRCm39) A399V probably damaging Het
Ckap2l A G 2: 129,127,414 (GRCm39) S255P probably damaging Het
Clca3a1 T A 3: 144,436,558 (GRCm39) I842F probably benign Het
Cmc2 G T 8: 117,620,896 (GRCm39) H28Q probably damaging Het
Col11a2 C T 17: 34,262,291 (GRCm39) P176L probably benign Het
Csmd3 T C 15: 47,744,783 (GRCm39) D1404G probably damaging Het
Dld G A 12: 31,382,190 (GRCm39) P506S probably benign Het
Dsg3 T C 18: 20,672,927 (GRCm39) M866T probably benign Het
Ehd1 T C 19: 6,348,375 (GRCm39) I451T possibly damaging Het
Fosb T C 7: 19,041,152 (GRCm39) T114A probably benign Het
Foxd4 T A 19: 24,878,198 (GRCm39) M1L possibly damaging Het
Fstl5 T A 3: 76,615,108 (GRCm39) I723N probably benign Het
Gm10549 C A 18: 33,597,358 (GRCm39) probably benign Het
Gm11595 G A 11: 99,663,381 (GRCm39) R100C unknown Het
Hdlbp A G 1: 93,357,186 (GRCm39) S299P possibly damaging Het
Mast4 G A 13: 102,897,890 (GRCm39) R650C probably damaging Het
Micu3 A G 8: 40,819,238 (GRCm39) T306A probably benign Het
Mylk2 A G 2: 152,755,613 (GRCm39) Q259R possibly damaging Het
Nfkbiz T C 16: 55,642,325 (GRCm39) N31S probably damaging Het
Nisch A T 14: 30,893,444 (GRCm39) probably benign Het
Nudt17 T C 3: 96,615,080 (GRCm39) probably benign Het
Oprm1 A C 10: 6,780,063 (GRCm39) I242L probably damaging Het
Or13a26 T C 7: 140,284,616 (GRCm39) W151R probably damaging Het
Or14c39 T C 7: 86,343,760 (GRCm39) V32A probably benign Het
Or2y1d A C 11: 49,321,828 (GRCm39) H175P probably damaging Het
Otud6b A G 4: 14,826,496 (GRCm39) probably benign Het
Pamr1 A T 2: 102,472,519 (GRCm39) D606V probably damaging Het
Pcf11 T C 7: 92,308,817 (GRCm39) probably benign Het
Pom121l2 T C 13: 22,166,502 (GRCm39) S258P probably damaging Het
Rcsd1 T A 1: 165,483,403 (GRCm39) D196V possibly damaging Het
Sbf2 C T 7: 110,040,759 (GRCm39) R356Q probably damaging Het
Serpinf1 A G 11: 75,304,731 (GRCm39) probably null Het
Slc22a30 T G 19: 8,313,086 (GRCm39) probably benign Het
Strn4 G T 7: 16,550,384 (GRCm39) S36I probably benign Het
Taar6 A G 10: 23,861,177 (GRCm39) L123P probably damaging Het
Thbs1 G T 2: 117,943,137 (GRCm39) R5L unknown Het
Timp3 T C 10: 86,181,650 (GRCm39) Y174H probably benign Het
Uox C T 3: 146,330,332 (GRCm39) R163* probably null Het
Vcan A T 13: 89,852,951 (GRCm39) S670T probably damaging Het
Vmn1r65 A T 7: 6,011,651 (GRCm39) N194K possibly damaging Het
Other mutations in Trpm2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00730:Trpm2 APN 10 77,778,749 (GRCm39) splice site probably null
IGL00773:Trpm2 APN 10 77,785,048 (GRCm39) nonsense probably null
IGL00962:Trpm2 APN 10 77,779,750 (GRCm39) splice site probably benign
IGL01093:Trpm2 APN 10 77,768,114 (GRCm39) missense probably benign 0.04
IGL01124:Trpm2 APN 10 77,781,659 (GRCm39) splice site probably benign
IGL01301:Trpm2 APN 10 77,759,818 (GRCm39) missense probably damaging 1.00
IGL02094:Trpm2 APN 10 77,778,830 (GRCm39) nonsense probably null
IGL02175:Trpm2 APN 10 77,773,741 (GRCm39) missense probably benign 0.07
IGL02653:Trpm2 APN 10 77,748,503 (GRCm39) missense probably benign 0.19
IGL02667:Trpm2 APN 10 77,771,776 (GRCm39) missense probably damaging 1.00
IGL02668:Trpm2 APN 10 77,771,776 (GRCm39) missense probably damaging 1.00
IGL02828:Trpm2 APN 10 77,754,820 (GRCm39) missense probably benign 0.16
IGL02951:Trpm2 APN 10 77,765,112 (GRCm39) missense possibly damaging 0.95
IGL03188:Trpm2 APN 10 77,754,743 (GRCm39) missense probably benign 0.18
IGL03242:Trpm2 APN 10 77,753,568 (GRCm39) missense probably benign
IGL03405:Trpm2 APN 10 77,801,906 (GRCm39) splice site probably benign
Fugit UTSW 10 77,774,202 (GRCm39) missense probably damaging 1.00
scusate UTSW 10 77,802,828 (GRCm39) nonsense probably null
temporal UTSW 10 77,761,516 (GRCm39) missense probably benign 0.30
ANU18:Trpm2 UTSW 10 77,759,818 (GRCm39) missense probably damaging 1.00
R0147:Trpm2 UTSW 10 77,761,659 (GRCm39) missense probably damaging 1.00
R0148:Trpm2 UTSW 10 77,761,659 (GRCm39) missense probably damaging 1.00
R0302:Trpm2 UTSW 10 77,779,824 (GRCm39) splice site probably benign
R0332:Trpm2 UTSW 10 77,783,822 (GRCm39) missense probably damaging 1.00
R0586:Trpm2 UTSW 10 77,759,350 (GRCm39) missense probably damaging 0.99
R0847:Trpm2 UTSW 10 77,765,122 (GRCm39) missense possibly damaging 0.94
R1183:Trpm2 UTSW 10 77,759,398 (GRCm39) missense probably damaging 1.00
R1472:Trpm2 UTSW 10 77,801,841 (GRCm39) missense probably damaging 1.00
R1510:Trpm2 UTSW 10 77,802,828 (GRCm39) nonsense probably null
R1518:Trpm2 UTSW 10 77,778,839 (GRCm39) missense possibly damaging 0.67
R1564:Trpm2 UTSW 10 77,778,833 (GRCm39) missense probably benign 0.14
R1593:Trpm2 UTSW 10 77,778,910 (GRCm39) missense possibly damaging 0.71
R1617:Trpm2 UTSW 10 77,771,709 (GRCm39) splice site probably null
R1673:Trpm2 UTSW 10 77,778,778 (GRCm39) missense probably benign
R1912:Trpm2 UTSW 10 77,781,710 (GRCm39) missense probably benign 0.10
R1932:Trpm2 UTSW 10 77,776,992 (GRCm39) missense probably damaging 1.00
R1993:Trpm2 UTSW 10 77,783,823 (GRCm39) missense probably damaging 1.00
R2013:Trpm2 UTSW 10 77,761,600 (GRCm39) missense probably damaging 1.00
R2151:Trpm2 UTSW 10 77,768,013 (GRCm39) missense probably benign 0.01
R2201:Trpm2 UTSW 10 77,756,305 (GRCm39) nonsense probably null
R2217:Trpm2 UTSW 10 77,777,016 (GRCm39) missense probably damaging 1.00
R2312:Trpm2 UTSW 10 77,754,798 (GRCm39) missense probably benign 0.04
R2339:Trpm2 UTSW 10 77,750,640 (GRCm39) splice site probably benign
R2395:Trpm2 UTSW 10 77,783,714 (GRCm39) missense possibly damaging 0.69
R2396:Trpm2 UTSW 10 77,766,471 (GRCm39) missense probably benign 0.14
R2405:Trpm2 UTSW 10 77,770,558 (GRCm39) missense probably damaging 1.00
R2567:Trpm2 UTSW 10 77,777,008 (GRCm39) missense probably damaging 0.99
R3001:Trpm2 UTSW 10 77,766,368 (GRCm39) critical splice donor site probably null
R3002:Trpm2 UTSW 10 77,766,368 (GRCm39) critical splice donor site probably null
R3125:Trpm2 UTSW 10 77,747,208 (GRCm39) missense probably damaging 1.00
R3500:Trpm2 UTSW 10 77,768,136 (GRCm39) missense probably benign 0.03
R3777:Trpm2 UTSW 10 77,771,824 (GRCm39) missense probably benign 0.13
R3778:Trpm2 UTSW 10 77,771,824 (GRCm39) missense probably benign 0.13
R4272:Trpm2 UTSW 10 77,769,476 (GRCm39) missense probably damaging 1.00
R4384:Trpm2 UTSW 10 77,753,559 (GRCm39) missense probably benign 0.44
R4395:Trpm2 UTSW 10 77,765,053 (GRCm39) missense probably benign 0.01
R4423:Trpm2 UTSW 10 77,770,902 (GRCm39) missense probably benign 0.00
R4452:Trpm2 UTSW 10 77,759,427 (GRCm39) missense probably damaging 1.00
R4612:Trpm2 UTSW 10 77,781,750 (GRCm39) missense probably damaging 0.99
R4662:Trpm2 UTSW 10 77,773,972 (GRCm39) missense probably benign 0.05
R4825:Trpm2 UTSW 10 77,777,007 (GRCm39) missense probably damaging 0.98
R4906:Trpm2 UTSW 10 77,768,023 (GRCm39) nonsense probably null
R4943:Trpm2 UTSW 10 77,801,841 (GRCm39) missense probably damaging 1.00
R4948:Trpm2 UTSW 10 77,753,626 (GRCm39) missense probably benign 0.34
R5046:Trpm2 UTSW 10 77,801,852 (GRCm39) missense probably damaging 1.00
R5320:Trpm2 UTSW 10 77,759,355 (GRCm39) missense probably benign 0.06
R5523:Trpm2 UTSW 10 77,771,795 (GRCm39) missense probably benign 0.04
R5562:Trpm2 UTSW 10 77,795,773 (GRCm39) missense possibly damaging 0.71
R5623:Trpm2 UTSW 10 77,767,973 (GRCm39) missense probably damaging 0.96
R5628:Trpm2 UTSW 10 77,748,470 (GRCm39) missense probably benign 0.00
R5633:Trpm2 UTSW 10 77,774,187 (GRCm39) missense possibly damaging 0.71
R5817:Trpm2 UTSW 10 77,801,814 (GRCm39) missense probably damaging 1.00
R5989:Trpm2 UTSW 10 77,795,734 (GRCm39) missense probably damaging 1.00
R6018:Trpm2 UTSW 10 77,753,547 (GRCm39) missense probably benign 0.00
R6075:Trpm2 UTSW 10 77,770,877 (GRCm39) critical splice donor site probably null
R6092:Trpm2 UTSW 10 77,761,516 (GRCm39) missense probably benign 0.30
R6309:Trpm2 UTSW 10 77,774,202 (GRCm39) missense probably damaging 1.00
R6568:Trpm2 UTSW 10 77,773,660 (GRCm39) missense probably benign 0.01
R6579:Trpm2 UTSW 10 77,773,660 (GRCm39) missense probably benign 0.01
R6640:Trpm2 UTSW 10 77,773,660 (GRCm39) missense probably benign 0.01
R6642:Trpm2 UTSW 10 77,773,660 (GRCm39) missense probably benign 0.01
R6798:Trpm2 UTSW 10 77,750,574 (GRCm39) missense probably damaging 0.99
R6999:Trpm2 UTSW 10 77,771,725 (GRCm39) missense probably damaging 1.00
R7034:Trpm2 UTSW 10 77,748,426 (GRCm39) missense probably benign
R7036:Trpm2 UTSW 10 77,748,426 (GRCm39) missense probably benign
R7113:Trpm2 UTSW 10 77,783,765 (GRCm39) missense probably damaging 0.96
R7171:Trpm2 UTSW 10 77,759,848 (GRCm39) missense probably damaging 1.00
R7240:Trpm2 UTSW 10 77,771,710 (GRCm39) critical splice donor site probably null
R7274:Trpm2 UTSW 10 77,759,389 (GRCm39) missense probably benign 0.00
R7379:Trpm2 UTSW 10 77,750,568 (GRCm39) missense probably benign
R7527:Trpm2 UTSW 10 77,801,894 (GRCm39) missense probably benign 0.01
R7571:Trpm2 UTSW 10 77,773,784 (GRCm39) missense probably benign 0.21
R7600:Trpm2 UTSW 10 77,773,885 (GRCm39) missense probably benign 0.02
R7727:Trpm2 UTSW 10 77,761,623 (GRCm39) missense probably benign 0.34
R7771:Trpm2 UTSW 10 77,768,013 (GRCm39) missense probably benign 0.01
R7844:Trpm2 UTSW 10 77,759,340 (GRCm39) missense probably benign 0.00
R8158:Trpm2 UTSW 10 77,783,731 (GRCm39) missense probably damaging 0.99
R8225:Trpm2 UTSW 10 77,783,807 (GRCm39) missense probably damaging 1.00
R8226:Trpm2 UTSW 10 77,783,807 (GRCm39) missense probably damaging 1.00
R8239:Trpm2 UTSW 10 77,771,836 (GRCm39) missense probably benign 0.06
R8275:Trpm2 UTSW 10 77,801,859 (GRCm39) nonsense probably null
R8340:Trpm2 UTSW 10 77,759,458 (GRCm39) nonsense probably null
R8354:Trpm2 UTSW 10 77,769,483 (GRCm39) missense probably damaging 1.00
R8427:Trpm2 UTSW 10 77,747,236 (GRCm39) missense possibly damaging 0.93
R8445:Trpm2 UTSW 10 77,746,086 (GRCm39) missense probably damaging 1.00
R8769:Trpm2 UTSW 10 77,768,128 (GRCm39) missense probably benign 0.00
R9144:Trpm2 UTSW 10 77,765,122 (GRCm39) missense probably benign 0.01
R9286:Trpm2 UTSW 10 77,777,014 (GRCm39) missense probably benign 0.06
R9319:Trpm2 UTSW 10 77,785,032 (GRCm39) missense probably damaging 1.00
R9319:Trpm2 UTSW 10 77,778,776 (GRCm39) nonsense probably null
R9381:Trpm2 UTSW 10 77,747,191 (GRCm39) missense possibly damaging 0.90
R9457:Trpm2 UTSW 10 77,747,226 (GRCm39) missense possibly damaging 0.82
R9477:Trpm2 UTSW 10 77,747,224 (GRCm39) missense probably benign 0.12
R9547:Trpm2 UTSW 10 77,748,467 (GRCm39) missense probably benign 0.33
R9660:Trpm2 UTSW 10 77,766,389 (GRCm39) missense probably benign 0.00
R9663:Trpm2 UTSW 10 77,756,320 (GRCm39) missense probably benign 0.01
Z1177:Trpm2 UTSW 10 77,773,702 (GRCm39) missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- CCCAAGTGGAGAAGTAGGTACC -3'
(R):5'- TTGGGTATCAGGAGCGCTATTAC -3'

Sequencing Primer
(F):5'- AGAAGTAGGTACCCGCCTC -3'
(R):5'- ATCAGGAGCGCTATTACTTTCTGAG -3'
Posted On 2018-04-02