Incidental Mutation 'R6327:Serpinf1'
ID510482
Institutional Source Beutler Lab
Gene Symbol Serpinf1
Ensembl Gene ENSMUSG00000000753
Gene Nameserine (or cysteine) peptidase inhibitor, clade F, member 1
Synonymsalpha-2 antiplasmin, Pedfl, Pedf, pigment epithelium derived factor, EPC-1, Sdf3
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.195) question?
Stock #R6327 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location75409769-75422701 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to G at 75413905 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000000769 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000769] [ENSMUST00000125982] [ENSMUST00000137103] [ENSMUST00000138661] [ENSMUST00000155009] [ENSMUST00000168902]
Predicted Effect probably null
Transcript: ENSMUST00000000769
SMART Domains Protein: ENSMUSP00000000769
Gene: ENSMUSG00000000753

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
SERPIN 62 414 5.22e-128 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000125982
SMART Domains Protein: ENSMUSP00000126807
Gene: ENSMUSG00000000753

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:Serpin 55 147 4.9e-18 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000137103
SMART Domains Protein: ENSMUSP00000114761
Gene: ENSMUSG00000000753

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
SERPIN 62 210 7.93e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000138661
SMART Domains Protein: ENSMUSP00000121180
Gene: ENSMUSG00000000753

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
SERPIN 62 205 1.47e-2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139403
Predicted Effect probably benign
Transcript: ENSMUST00000155009
SMART Domains Protein: ENSMUSP00000131531
Gene: ENSMUSG00000000753

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
PDB:1IMV|A 27 64 2e-16 PDB
SCOP:d1imva_ 35 64 1e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000167281
SMART Domains Protein: ENSMUSP00000133230
Gene: ENSMUSG00000000753

DomainStartEndE-ValueType
Pfam:Serpin 1 122 7.9e-17 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000168902
SMART Domains Protein: ENSMUSP00000131043
Gene: ENSMUSG00000000753

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Meta Mutation Damage Score 0.9502 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.4%
Validation Efficiency 100% (43/43)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the serpin family that does not display the serine protease inhibitory activity shown by many of the other serpin proteins. The encoded protein is secreted and strongly inhibits angiogenesis. In addition, this protein is a neurotrophic factor involved in neuronal differentiation in retinoblastoma cells. Mutations in this gene were found in individuals with osteogenesis imperfecta, type VI. [provided by RefSeq, Aug 2016]
PHENOTYPE: Loss of function results in increased microvasculature, pancreatic enlargement, and prostatic hyperplasia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2ml1 T C 6: 128,558,692 probably null Het
Birc6 C A 17: 74,662,779 H383Q probably damaging Het
C2 C A 17: 34,864,103 A431S probably benign Het
C3ar1 C T 6: 122,850,146 V371M probably damaging Het
Chd1l G A 3: 97,587,167 A399V probably damaging Het
Ckap2l A G 2: 129,285,494 S255P probably damaging Het
Clca3a1 T A 3: 144,730,797 I842F probably benign Het
Cmc2 G T 8: 116,894,157 H28Q probably damaging Het
Col11a2 C T 17: 34,043,317 P176L probably benign Het
Csmd3 T C 15: 47,881,387 D1404G probably damaging Het
Dld G A 12: 31,332,191 P506S probably benign Het
Dsg3 T C 18: 20,539,870 M866T probably benign Het
Ehd1 T C 19: 6,298,345 I451T possibly damaging Het
Fosb T C 7: 19,307,227 T114A probably benign Het
Foxd4 T A 19: 24,900,834 M1L possibly damaging Het
Fstl5 T A 3: 76,707,801 I723N probably benign Het
Gm10549 C A 18: 33,464,305 probably benign Het
Gm11595 G A 11: 99,772,555 R100C unknown Het
Hdlbp A G 1: 93,429,464 S299P possibly damaging Het
Mast4 G A 13: 102,761,382 R650C probably damaging Het
Micu3 A G 8: 40,366,197 T306A probably benign Het
Mylk2 A G 2: 152,913,693 Q259R possibly damaging Het
Nfkbiz T C 16: 55,821,962 N31S probably damaging Het
Nisch A T 14: 31,171,487 probably benign Het
Nudt17 T C 3: 96,707,764 probably benign Het
Olfr1389 A C 11: 49,431,001 H175P probably damaging Het
Olfr292 T C 7: 86,694,552 V32A probably benign Het
Olfr541 T C 7: 140,704,703 W151R probably damaging Het
Oprm1 A C 10: 6,830,063 I242L probably damaging Het
Otud6b A G 4: 14,826,496 probably benign Het
Pamr1 A T 2: 102,642,174 D606V probably damaging Het
Pcf11 T C 7: 92,659,609 probably benign Het
Pom121l2 T C 13: 21,982,332 S258P probably damaging Het
Rcsd1 T A 1: 165,655,834 D196V possibly damaging Het
Sbf2 C T 7: 110,441,552 R356Q probably damaging Het
Slc22a30 T G 19: 8,335,722 probably benign Het
Strn4 G T 7: 16,816,459 S36I probably benign Het
Taar6 A G 10: 23,985,279 L123P probably damaging Het
Thbs1 G T 2: 118,112,656 R5L unknown Het
Timp3 T C 10: 86,345,786 Y174H probably benign Het
Trpm2 C T 10: 77,932,227 V813M probably damaging Het
Uox C T 3: 146,624,577 R163* probably null Het
Vcan A T 13: 89,704,832 S670T probably damaging Het
Vmn1r65 A T 7: 6,008,652 N194K possibly damaging Het
Other mutations in Serpinf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
clenched UTSW 11 75413905 critical splice donor site probably null
R0306:Serpinf1 UTSW 11 75413935 missense probably damaging 1.00
R0379:Serpinf1 UTSW 11 75413945 missense probably benign 0.25
R1588:Serpinf1 UTSW 11 75410250 missense probably damaging 0.99
R1720:Serpinf1 UTSW 11 75413981 missense probably null 0.26
R1917:Serpinf1 UTSW 11 75411007 missense possibly damaging 0.72
R1961:Serpinf1 UTSW 11 75416419 missense probably benign 0.01
R4704:Serpinf1 UTSW 11 75411041 missense probably damaging 0.99
R5138:Serpinf1 UTSW 11 75415028 missense probably damaging 1.00
R5618:Serpinf1 UTSW 11 75410184 missense possibly damaging 0.47
R7031:Serpinf1 UTSW 11 75410196 missense probably damaging 1.00
R7171:Serpinf1 UTSW 11 75417985 missense possibly damaging 0.88
R7436:Serpinf1 UTSW 11 75416316 missense probably benign 0.11
Predicted Primers PCR Primer
(F):5'- GAAAACCCATTCTCGTGACCTTG -3'
(R):5'- AGGATGCTCCATCTGTTTCC -3'

Sequencing Primer
(F):5'- CCCTGGGAGAATGAGTTCTGATAAC -3'
(R):5'- CTTCCAGGGCAGTGGGTAAC -3'
Posted On2018-04-02