Incidental Mutation 'R6327:Gm11595'
ID510483
Institutional Source Beutler Lab
Gene Symbol Gm11595
Ensembl Gene ENSMUSG00000078668
Gene Namepredicted gene 11595
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.077) question?
Stock #R6327 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location99771714-99772913 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 99772555 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Cysteine at position 100 (R100C)
Ref Sequence ENSEMBL: ENSMUSP00000103064 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000107440]
Predicted Effect unknown
Transcript: ENSMUST00000107440
AA Change: R100C
SMART Domains Protein: ENSMUSP00000103064
Gene: ENSMUSG00000078668
AA Change: R100C

DomainStartEndE-ValueType
Pfam:Keratin_B2_2 1 47 7.5e-9 PFAM
Pfam:Keratin_B2_2 14 58 2.8e-13 PFAM
Pfam:Keratin_B2_2 29 73 1.2e-13 PFAM
Pfam:Keratin_B2_2 72 112 2.3e-12 PFAM
Pfam:Keratin_B2_2 107 152 4.6e-14 PFAM
Pfam:Keratin_B2_2 118 162 1.1e-13 PFAM
Pfam:Keratin_B2_2 143 187 3.5e-10 PFAM
Pfam:Keratin_B2_2 168 212 5.6e-13 PFAM
Pfam:Keratin_B2_2 178 222 2.4e-12 PFAM
Pfam:Keratin_B2_2 208 257 1.6e-11 PFAM
Pfam:Keratin_B2_2 223 267 4e-14 PFAM
Pfam:Keratin_B2_2 248 289 9e-9 PFAM
Meta Mutation Damage Score 0.0869 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.4%
Validation Efficiency 100% (43/43)
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2ml1 T C 6: 128,558,692 probably null Het
Birc6 C A 17: 74,662,779 H383Q probably damaging Het
C2 C A 17: 34,864,103 A431S probably benign Het
C3ar1 C T 6: 122,850,146 V371M probably damaging Het
Chd1l G A 3: 97,587,167 A399V probably damaging Het
Ckap2l A G 2: 129,285,494 S255P probably damaging Het
Clca3a1 T A 3: 144,730,797 I842F probably benign Het
Cmc2 G T 8: 116,894,157 H28Q probably damaging Het
Col11a2 C T 17: 34,043,317 P176L probably benign Het
Csmd3 T C 15: 47,881,387 D1404G probably damaging Het
Dld G A 12: 31,332,191 P506S probably benign Het
Dsg3 T C 18: 20,539,870 M866T probably benign Het
Ehd1 T C 19: 6,298,345 I451T possibly damaging Het
Fosb T C 7: 19,307,227 T114A probably benign Het
Foxd4 T A 19: 24,900,834 M1L possibly damaging Het
Fstl5 T A 3: 76,707,801 I723N probably benign Het
Gm10549 C A 18: 33,464,305 probably benign Het
Hdlbp A G 1: 93,429,464 S299P possibly damaging Het
Mast4 G A 13: 102,761,382 R650C probably damaging Het
Micu3 A G 8: 40,366,197 T306A probably benign Het
Mylk2 A G 2: 152,913,693 Q259R possibly damaging Het
Nfkbiz T C 16: 55,821,962 N31S probably damaging Het
Nisch A T 14: 31,171,487 probably benign Het
Nudt17 T C 3: 96,707,764 probably benign Het
Olfr1389 A C 11: 49,431,001 H175P probably damaging Het
Olfr292 T C 7: 86,694,552 V32A probably benign Het
Olfr541 T C 7: 140,704,703 W151R probably damaging Het
Oprm1 A C 10: 6,830,063 I242L probably damaging Het
Otud6b A G 4: 14,826,496 probably benign Het
Pamr1 A T 2: 102,642,174 D606V probably damaging Het
Pcf11 T C 7: 92,659,609 probably benign Het
Pom121l2 T C 13: 21,982,332 S258P probably damaging Het
Rcsd1 T A 1: 165,655,834 D196V possibly damaging Het
Sbf2 C T 7: 110,441,552 R356Q probably damaging Het
Serpinf1 A G 11: 75,413,905 probably null Het
Slc22a30 T G 19: 8,335,722 probably benign Het
Strn4 G T 7: 16,816,459 S36I probably benign Het
Taar6 A G 10: 23,985,279 L123P probably damaging Het
Thbs1 G T 2: 118,112,656 R5L unknown Het
Timp3 T C 10: 86,345,786 Y174H probably benign Het
Trpm2 C T 10: 77,932,227 V813M probably damaging Het
Uox C T 3: 146,624,577 R163* probably null Het
Vcan A T 13: 89,704,832 S670T probably damaging Het
Vmn1r65 A T 7: 6,008,652 N194K possibly damaging Het
Other mutations in Gm11595
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00579:Gm11595 APN 11 99772042 missense unknown
IGL00987:Gm11595 APN 11 99772539 missense unknown
IGL01662:Gm11595 APN 11 99772672 missense unknown
IGL01994:Gm11595 APN 11 99772201 missense unknown
R0548:Gm11595 UTSW 11 99772141 missense unknown
R1923:Gm11595 UTSW 11 99772539 missense unknown
R2127:Gm11595 UTSW 11 99772501 missense unknown
R2128:Gm11595 UTSW 11 99772501 missense unknown
R3807:Gm11595 UTSW 11 99772554 missense unknown
R4007:Gm11595 UTSW 11 99772035 missense unknown
R5281:Gm11595 UTSW 11 99772555 missense unknown
R5283:Gm11595 UTSW 11 99772555 missense unknown
R5303:Gm11595 UTSW 11 99772555 missense unknown
R5305:Gm11595 UTSW 11 99772555 missense unknown
R5306:Gm11595 UTSW 11 99772555 missense unknown
R5307:Gm11595 UTSW 11 99772555 missense unknown
R5308:Gm11595 UTSW 11 99772555 missense unknown
R5561:Gm11595 UTSW 11 99772555 missense unknown
R5637:Gm11595 UTSW 11 99772555 missense unknown
R5639:Gm11595 UTSW 11 99772555 missense unknown
R5718:Gm11595 UTSW 11 99772555 missense unknown
R5719:Gm11595 UTSW 11 99772555 missense unknown
R5720:Gm11595 UTSW 11 99772555 missense unknown
R5721:Gm11595 UTSW 11 99772555 missense unknown
R5769:Gm11595 UTSW 11 99772555 missense unknown
R5770:Gm11595 UTSW 11 99772555 missense unknown
R5771:Gm11595 UTSW 11 99772555 missense unknown
R5791:Gm11595 UTSW 11 99772555 missense unknown
R5841:Gm11595 UTSW 11 99772317 missense unknown
R6054:Gm11595 UTSW 11 99772648 missense unknown
R6277:Gm11595 UTSW 11 99772684 missense unknown
R6281:Gm11595 UTSW 11 99772555 missense unknown
R6282:Gm11595 UTSW 11 99772555 missense unknown
R6310:Gm11595 UTSW 11 99772555 missense unknown
R6321:Gm11595 UTSW 11 99772555 missense unknown
R6322:Gm11595 UTSW 11 99772555 missense unknown
R6337:Gm11595 UTSW 11 99772555 missense unknown
R6368:Gm11595 UTSW 11 99772555 missense unknown
R6369:Gm11595 UTSW 11 99772555 missense unknown
R6431:Gm11595 UTSW 11 99772774 missense unknown
R6483:Gm11595 UTSW 11 99772555 missense unknown
R6485:Gm11595 UTSW 11 99772555 missense unknown
R6493:Gm11595 UTSW 11 99772555 missense unknown
R6758:Gm11595 UTSW 11 99772540 missense unknown
R6758:Gm11595 UTSW 11 99772541 nonsense probably null
R7037:Gm11595 UTSW 11 99772648 missense unknown
R8053:Gm11595 UTSW 11 99772128 missense unknown
Predicted Primers PCR Primer
(F):5'- TAGAACTACCACAGCAGGGG -3'
(R):5'- ACCATGGTCAGTTCCTGTTGTG -3'

Sequencing Primer
(F):5'- CGACAGCAGCTGGAGATG -3'
(R):5'- TGCCAGACCACCTGCTGTAG -3'
Posted On2018-04-02