Incidental Mutation 'R6327:Dld'
ID510484
Institutional Source Beutler Lab
Gene Symbol Dld
Ensembl Gene ENSMUSG00000020664
Gene Namedihydrolipoamide dehydrogenase
Synonymsbranched chain alpha-keto acid dehydrogenase complex subunit E3, dihydrolipoyl dehydrogenase
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.967) question?
Stock #R6327 (G1)
Quality Score225.009
Status Validated
Chromosome12
Chromosomal Location31331277-31351453 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 31332191 bp
ZygosityHeterozygous
Amino Acid Change Proline to Serine at position 506 (P506S)
Ref Sequence ENSEMBL: ENSMUSP00000106481 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002979] [ENSMUST00000110857] [ENSMUST00000169088]
Predicted Effect probably benign
Transcript: ENSMUST00000002979
SMART Domains Protein: ENSMUSP00000002979
Gene: ENSMUSG00000002900

DomainStartEndE-ValueType
low complexity region 32 45 N/A INTRINSIC
LamNT 77 317 3.24e-96 SMART
EGF_Lam 319 380 1.34e-6 SMART
EGF_Lam 383 443 1.33e-10 SMART
EGF_Lam 446 503 2.89e-11 SMART
EGF_Lam 506 555 2.89e-11 SMART
EGF_Lam 558 602 3.4e-8 SMART
EGF_Lam 821 866 4.99e-15 SMART
EGF_Lam 869 912 2.38e-12 SMART
EGF_Lam 915 962 2.4e-8 SMART
EGF_Lam 965 1021 1.41e-5 SMART
EGF_Lam 1024 1073 4.81e-8 SMART
EGF_Lam 1076 1129 3.81e-11 SMART
EGF_Lam 1132 1177 5.61e-9 SMART
EGF_Lam 1180 1224 2.89e-11 SMART
coiled coil region 1329 1360 N/A INTRINSIC
low complexity region 1468 1480 N/A INTRINSIC
coiled coil region 1497 1551 N/A INTRINSIC
coiled coil region 1600 1826 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000110857
AA Change: P506S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000106481
Gene: ENSMUSG00000020664
AA Change: P506S

DomainStartEndE-ValueType
Pfam:Pyr_redox_2 42 370 2.3e-71 PFAM
Pfam:FAD_binding_2 43 83 2.5e-7 PFAM
Pfam:GIDA 43 111 1.7e-8 PFAM
Pfam:FAD_oxidored 43 135 4.3e-10 PFAM
Pfam:NAD_binding_8 46 100 1.4e-6 PFAM
Pfam:Pyr_redox 215 298 4.9e-17 PFAM
Pfam:Pyr_redox_dim 389 498 1.6e-43 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000169088
SMART Domains Protein: ENSMUSP00000132778
Gene: ENSMUSG00000002900

DomainStartEndE-ValueType
LamNT 29 269 3.24e-96 SMART
EGF_Lam 271 332 1.34e-6 SMART
EGF_Lam 335 395 1.33e-10 SMART
EGF_Lam 398 455 2.89e-11 SMART
EGF_Lam 458 507 2.89e-11 SMART
EGF_Lam 510 554 3.4e-8 SMART
EGF_Lam 773 818 4.99e-15 SMART
EGF_Lam 821 864 2.38e-12 SMART
EGF_Lam 867 914 2.4e-8 SMART
EGF_Lam 917 973 1.41e-5 SMART
EGF_Lam 976 1025 4.81e-8 SMART
EGF_Lam 1028 1081 3.81e-11 SMART
EGF_Lam 1084 1129 5.61e-9 SMART
EGF_Lam 1132 1176 2.89e-11 SMART
coiled coil region 1281 1312 N/A INTRINSIC
low complexity region 1420 1432 N/A INTRINSIC
coiled coil region 1449 1503 N/A INTRINSIC
coiled coil region 1552 1778 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218624
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.4%
Validation Efficiency 100% (43/43)
MGI Phenotype FUNCTION: This gene encodes a member of the class-I pyridine nucleotide-disulfide oxidoreductase family. The encoded protein has been identified as a moonlighting protein based on its ability to perform mechanistically distinct functions. In homodimeric form, the encoded protein functions as a dehydrogenase and is found in several multi-enzyme complexes that regulate energy metabolism. However, as a monomer, this protein can function as a protease. [provided by RefSeq, Jan 2014]
PHENOTYPE: Embryos homozygous for a targeted null mutation exhibit a developmental delay at 7.5 days postcoitum and are resorbed by 9.5 days postcoitum. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2ml1 T C 6: 128,558,692 probably null Het
Birc6 C A 17: 74,662,779 H383Q probably damaging Het
C2 C A 17: 34,864,103 A431S probably benign Het
C3ar1 C T 6: 122,850,146 V371M probably damaging Het
Chd1l G A 3: 97,587,167 A399V probably damaging Het
Ckap2l A G 2: 129,285,494 S255P probably damaging Het
Clca3a1 T A 3: 144,730,797 I842F probably benign Het
Cmc2 G T 8: 116,894,157 H28Q probably damaging Het
Col11a2 C T 17: 34,043,317 P176L probably benign Het
Csmd3 T C 15: 47,881,387 D1404G probably damaging Het
Dsg3 T C 18: 20,539,870 M866T probably benign Het
Ehd1 T C 19: 6,298,345 I451T possibly damaging Het
Fosb T C 7: 19,307,227 T114A probably benign Het
Foxd4 T A 19: 24,900,834 M1L possibly damaging Het
Fstl5 T A 3: 76,707,801 I723N probably benign Het
Gm10549 C A 18: 33,464,305 probably benign Het
Gm11595 G A 11: 99,772,555 R100C unknown Het
Hdlbp A G 1: 93,429,464 S299P possibly damaging Het
Mast4 G A 13: 102,761,382 R650C probably damaging Het
Micu3 A G 8: 40,366,197 T306A probably benign Het
Mylk2 A G 2: 152,913,693 Q259R possibly damaging Het
Nfkbiz T C 16: 55,821,962 N31S probably damaging Het
Nisch A T 14: 31,171,487 probably benign Het
Nudt17 T C 3: 96,707,764 probably benign Het
Olfr1389 A C 11: 49,431,001 H175P probably damaging Het
Olfr292 T C 7: 86,694,552 V32A probably benign Het
Olfr541 T C 7: 140,704,703 W151R probably damaging Het
Oprm1 A C 10: 6,830,063 I242L probably damaging Het
Otud6b A G 4: 14,826,496 probably benign Het
Pamr1 A T 2: 102,642,174 D606V probably damaging Het
Pcf11 T C 7: 92,659,609 probably benign Het
Pom121l2 T C 13: 21,982,332 S258P probably damaging Het
Rcsd1 T A 1: 165,655,834 D196V possibly damaging Het
Sbf2 C T 7: 110,441,552 R356Q probably damaging Het
Serpinf1 A G 11: 75,413,905 probably null Het
Slc22a30 T G 19: 8,335,722 probably benign Het
Strn4 G T 7: 16,816,459 S36I probably benign Het
Taar6 A G 10: 23,985,279 L123P probably damaging Het
Thbs1 G T 2: 118,112,656 R5L unknown Het
Timp3 T C 10: 86,345,786 Y174H probably benign Het
Trpm2 C T 10: 77,932,227 V813M probably damaging Het
Uox C T 3: 146,624,577 R163* probably null Het
Vcan A T 13: 89,704,832 S670T probably damaging Het
Vmn1r65 A T 7: 6,008,652 N194K possibly damaging Het
Other mutations in Dld
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00094:Dld APN 12 31335577 missense probably benign
IGL00656:Dld APN 12 31349595 critical splice donor site probably null
IGL00907:Dld APN 12 31332330 unclassified probably benign
IGL01870:Dld APN 12 31335467 missense possibly damaging 0.89
IGL02654:Dld APN 12 31333917 missense probably benign 0.19
IGL02666:Dld APN 12 31332409 missense probably null 0.00
PIT4544001:Dld UTSW 12 31335557 nonsense probably null
R0973:Dld UTSW 12 31334054 missense probably damaging 1.00
R1748:Dld UTSW 12 31334746 missense probably benign
R2225:Dld UTSW 12 31341449 missense probably benign 0.01
R4614:Dld UTSW 12 31333945 nonsense probably null
R5933:Dld UTSW 12 31333983 missense probably benign 0.00
R5966:Dld UTSW 12 31340326 missense probably damaging 1.00
R6088:Dld UTSW 12 31340989 missense probably benign
R6190:Dld UTSW 12 31344848 missense probably damaging 1.00
R6750:Dld UTSW 12 31332214 missense probably benign 0.00
R7149:Dld UTSW 12 31335590 missense probably benign
R7414:Dld UTSW 12 31335526 missense probably damaging 1.00
R7730:Dld UTSW 12 31340865 missense probably benign 0.00
X0065:Dld UTSW 12 31341389 nonsense probably null
Predicted Primers PCR Primer
(F):5'- ATGCACTGGAACAAGATACGTG -3'
(R):5'- CATTGGAATATGGTGCTTCCTG -3'

Sequencing Primer
(F):5'- CTGGAACAAGATACGTGAAATATAGG -3'
(R):5'- TGAAGATATAGCTCGAGTCTGCC -3'
Posted On2018-04-02