Incidental Mutation 'R6327:Pom121l2'
ID510485
Institutional Source Beutler Lab
Gene Symbol Pom121l2
Ensembl Gene ENSMUSG00000016982
Gene NamePOM121 membrane glycoprotein-like 2 (rat)
SynonymsLOC195236
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.058) question?
Stock #R6327 (G1)
Quality Score225.009
Status Validated
Chromosome13
Chromosomal Location21981194-21988734 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 21982332 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 258 (S258P)
Ref Sequence ENSEMBL: ENSMUSP00000113688 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000017126] [ENSMUST00000117882]
Predicted Effect probably damaging
Transcript: ENSMUST00000017126
AA Change: S258P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000017126
Gene: ENSMUSG00000016982
AA Change: S258P

DomainStartEndE-ValueType
low complexity region 42 60 N/A INTRINSIC
Pfam:POM121 162 301 3.5e-24 PFAM
low complexity region 367 379 N/A INTRINSIC
low complexity region 413 433 N/A INTRINSIC
low complexity region 517 526 N/A INTRINSIC
low complexity region 558 572 N/A INTRINSIC
low complexity region 697 712 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000117882
AA Change: S258P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000113688
Gene: ENSMUSG00000016982
AA Change: S258P

DomainStartEndE-ValueType
low complexity region 42 60 N/A INTRINSIC
Pfam:POM121 162 301 2e-24 PFAM
low complexity region 367 379 N/A INTRINSIC
low complexity region 413 433 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.4%
Validation Efficiency 100% (43/43)
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2ml1 T C 6: 128,558,692 probably null Het
Birc6 C A 17: 74,662,779 H383Q probably damaging Het
C2 C A 17: 34,864,103 A431S probably benign Het
C3ar1 C T 6: 122,850,146 V371M probably damaging Het
Chd1l G A 3: 97,587,167 A399V probably damaging Het
Ckap2l A G 2: 129,285,494 S255P probably damaging Het
Clca3a1 T A 3: 144,730,797 I842F probably benign Het
Cmc2 G T 8: 116,894,157 H28Q probably damaging Het
Col11a2 C T 17: 34,043,317 P176L probably benign Het
Csmd3 T C 15: 47,881,387 D1404G probably damaging Het
Dld G A 12: 31,332,191 P506S probably benign Het
Dsg3 T C 18: 20,539,870 M866T probably benign Het
Ehd1 T C 19: 6,298,345 I451T possibly damaging Het
Fosb T C 7: 19,307,227 T114A probably benign Het
Foxd4 T A 19: 24,900,834 M1L possibly damaging Het
Fstl5 T A 3: 76,707,801 I723N probably benign Het
Gm10549 C A 18: 33,464,305 probably benign Het
Gm11595 G A 11: 99,772,555 R100C unknown Het
Hdlbp A G 1: 93,429,464 S299P possibly damaging Het
Mast4 G A 13: 102,761,382 R650C probably damaging Het
Micu3 A G 8: 40,366,197 T306A probably benign Het
Mylk2 A G 2: 152,913,693 Q259R possibly damaging Het
Nfkbiz T C 16: 55,821,962 N31S probably damaging Het
Nisch A T 14: 31,171,487 probably benign Het
Nudt17 T C 3: 96,707,764 probably benign Het
Olfr1389 A C 11: 49,431,001 H175P probably damaging Het
Olfr292 T C 7: 86,694,552 V32A probably benign Het
Olfr541 T C 7: 140,704,703 W151R probably damaging Het
Oprm1 A C 10: 6,830,063 I242L probably damaging Het
Otud6b A G 4: 14,826,496 probably benign Het
Pamr1 A T 2: 102,642,174 D606V probably damaging Het
Pcf11 T C 7: 92,659,609 probably benign Het
Rcsd1 T A 1: 165,655,834 D196V possibly damaging Het
Sbf2 C T 7: 110,441,552 R356Q probably damaging Het
Serpinf1 A G 11: 75,413,905 probably null Het
Slc22a30 T G 19: 8,335,722 probably benign Het
Strn4 G T 7: 16,816,459 S36I probably benign Het
Taar6 A G 10: 23,985,279 L123P probably damaging Het
Thbs1 G T 2: 118,112,656 R5L unknown Het
Timp3 T C 10: 86,345,786 Y174H probably benign Het
Trpm2 C T 10: 77,932,227 V813M probably damaging Het
Uox C T 3: 146,624,577 R163* probably null Het
Vcan A T 13: 89,704,832 S670T probably damaging Het
Vmn1r65 A T 7: 6,008,652 N194K possibly damaging Het
Other mutations in Pom121l2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02104:Pom121l2 APN 13 21982275 missense possibly damaging 0.70
IGL02223:Pom121l2 APN 13 21982095 missense probably benign 0.01
R0401:Pom121l2 UTSW 13 21982225 missense probably benign 0.01
R0402:Pom121l2 UTSW 13 21988479 splice site probably benign
R0437:Pom121l2 UTSW 13 21983205 missense possibly damaging 0.72
R0575:Pom121l2 UTSW 13 21984168 missense probably damaging 0.99
R0605:Pom121l2 UTSW 13 21982036 missense probably damaging 1.00
R0892:Pom121l2 UTSW 13 21982474 missense possibly damaging 0.49
R0992:Pom121l2 UTSW 13 21982759 missense probably benign 0.01
R1259:Pom121l2 UTSW 13 21982127 nonsense probably null
R1564:Pom121l2 UTSW 13 21983353 missense possibly damaging 0.86
R1603:Pom121l2 UTSW 13 21983344 missense probably damaging 1.00
R1836:Pom121l2 UTSW 13 21983784 missense probably benign 0.03
R1970:Pom121l2 UTSW 13 21983472 missense probably damaging 0.98
R2018:Pom121l2 UTSW 13 21982734 missense possibly damaging 0.54
R2180:Pom121l2 UTSW 13 21981975 missense probably benign 0.08
R2277:Pom121l2 UTSW 13 21984247 missense probably benign
R2365:Pom121l2 UTSW 13 21983784 missense probably benign 0.20
R3951:Pom121l2 UTSW 13 21982128 missense probably damaging 1.00
R4371:Pom121l2 UTSW 13 21982239 missense probably benign 0.01
R4574:Pom121l2 UTSW 13 21984402 missense probably benign 0.02
R4593:Pom121l2 UTSW 13 21984453 missense probably damaging 1.00
R4983:Pom121l2 UTSW 13 21983814 missense probably benign 0.02
R5320:Pom121l2 UTSW 13 21981845 nonsense probably null
R5661:Pom121l2 UTSW 13 21984255 missense possibly damaging 0.90
R5662:Pom121l2 UTSW 13 21982188 missense probably benign 0.01
R5908:Pom121l2 UTSW 13 21981814 missense probably damaging 0.99
R5980:Pom121l2 UTSW 13 21983376 missense probably damaging 0.96
R6145:Pom121l2 UTSW 13 21982302 nonsense probably null
R6160:Pom121l2 UTSW 13 21983668 missense possibly damaging 0.52
R6504:Pom121l2 UTSW 13 21983461 missense possibly damaging 0.55
R6745:Pom121l2 UTSW 13 21983698 missense probably benign 0.00
R6750:Pom121l2 UTSW 13 21981937 missense probably damaging 1.00
R6752:Pom121l2 UTSW 13 21981769 missense probably damaging 0.99
R6796:Pom121l2 UTSW 13 21983524 missense probably benign 0.09
R6984:Pom121l2 UTSW 13 21982021 missense probably benign 0.33
R7284:Pom121l2 UTSW 13 21982605 missense probably damaging 1.00
R7287:Pom121l2 UTSW 13 21984332 missense probably benign 0.16
R7568:Pom121l2 UTSW 13 21982626 missense probably benign 0.03
R7624:Pom121l2 UTSW 13 21983529 missense probably damaging 0.97
R7832:Pom121l2 UTSW 13 21983878 missense possibly damaging 0.49
R7956:Pom121l2 UTSW 13 21983146 missense probably damaging 1.00
R8103:Pom121l2 UTSW 13 21982374 missense probably benign 0.00
R8506:Pom121l2 UTSW 13 21983619 missense probably benign 0.04
Z1177:Pom121l2 UTSW 13 21988486 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- TGTTGAAAAGTGGGGCCAC -3'
(R):5'- GTGACAACAGGACCTTGCTG -3'

Sequencing Primer
(F):5'- CCACTGTTTCGTTTGTGGCCAG -3'
(R):5'- TATAGTTAGCAGGTCCCTAGGGCC -3'
Posted On2018-04-02