Incidental Mutation 'R6327:Nisch'
ID510488
Institutional Source Beutler Lab
Gene Symbol Nisch
Ensembl Gene ENSMUSG00000021910
Gene Namenischarin
Synonyms1200007D05Rik, 3202002H23Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6327 (G1)
Quality Score225.009
Status Validated
Chromosome14
Chromosomal Location31170930-31216946 bp(-) (GRCm38)
Type of Mutationutr 3 prime
DNA Base Change (assembly) A to T at 31171487 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000131465 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022469] [ENSMUST00000036618] [ENSMUST00000167449] [ENSMUST00000168206] [ENSMUST00000169628]
Predicted Effect probably benign
Transcript: ENSMUST00000022469
SMART Domains Protein: ENSMUSP00000022469
Gene: ENSMUSG00000021910

DomainStartEndE-ValueType
PX 15 119 2.17e-26 SMART
PDB:4PQ8|A 287 420 9e-8 PDB
SCOP:d1h6ta2 291 421 6e-29 SMART
Blast:LRR 311 332 5e-6 BLAST
Blast:LRR 333 355 6e-6 BLAST
Blast:LRR 378 403 5e-7 BLAST
Blast:LRR 403 429 6e-7 BLAST
low complexity region 489 501 N/A INTRINSIC
low complexity region 517 534 N/A INTRINSIC
coiled coil region 625 650 N/A INTRINSIC
low complexity region 662 695 N/A INTRINSIC
low complexity region 1038 1069 N/A INTRINSIC
low complexity region 1081 1193 N/A INTRINSIC
low complexity region 1491 1509 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000036618
SMART Domains Protein: ENSMUSP00000046199
Gene: ENSMUSG00000042286

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
EGF 112 149 6.65e-2 SMART
EGF 160 194 2.28e0 SMART
EGF 199 232 1.4e0 SMART
EGF 236 272 4.97e-1 SMART
EGF 276 319 1.95e1 SMART
EGF_like 321 357 5.03e1 SMART
low complexity region 400 413 N/A INTRINSIC
Blast:FAS1 414 501 2e-52 BLAST
FAS1 543 645 1.35e-24 SMART
EGF_like 780 817 5.45e1 SMART
EGF 822 861 1.08e-1 SMART
EGF 865 904 3.15e-3 SMART
EGF 908 947 1.3e1 SMART
EGF 951 989 1.47e1 SMART
FAS1 1023 1122 1.3e-17 SMART
FAS1 1165 1257 2.94e0 SMART
EGF 1332 1369 1.4e0 SMART
EGF 1379 1413 1.88e-1 SMART
EGF 1420 1455 6.02e0 SMART
EGF 1459 1497 3.82e-2 SMART
EGF 1501 1540 2.05e-2 SMART
EGF 1544 1583 2.25e1 SMART
FAS1 1616 1712 1.61e-22 SMART
FAS1 1763 1868 2.12e-17 SMART
EGF 1970 2007 1.26e-2 SMART
EGF 2017 2051 1.61e0 SMART
EGF 2059 2090 2.45e0 SMART
EGF 2094 2131 3.46e0 SMART
EGF 2135 2174 3.82e-2 SMART
LINK 2206 2301 8.55e-49 SMART
FAS1 2367 2462 2.06e-6 SMART
transmembrane domain 2476 2498 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159532
Predicted Effect noncoding transcript
Transcript: ENSMUST00000163552
SMART Domains Protein: ENSMUSP00000131689
Gene: ENSMUSG00000021910

DomainStartEndE-ValueType
low complexity region 96 127 N/A INTRINSIC
low complexity region 139 242 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000167449
Predicted Effect probably benign
Transcript: ENSMUST00000168206
SMART Domains Protein: ENSMUSP00000132842
Gene: ENSMUSG00000021910

DomainStartEndE-ValueType
Pfam:LRR_8 44 101 3.9e-9 PFAM
Pfam:LRR_1 45 66 2.6e-2 PFAM
Pfam:LRR_6 88 109 1.1e-2 PFAM
Pfam:LRR_4 89 132 6.5e-8 PFAM
Pfam:LRR_1 90 109 6.9e-2 PFAM
Blast:LRR 133 158 4e-7 BLAST
Blast:LRR 158 184 6e-7 BLAST
low complexity region 244 256 N/A INTRINSIC
low complexity region 272 289 N/A INTRINSIC
coiled coil region 380 405 N/A INTRINSIC
low complexity region 417 450 N/A INTRINSIC
low complexity region 793 824 N/A INTRINSIC
low complexity region 836 948 N/A INTRINSIC
low complexity region 1246 1264 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000169628
SMART Domains Protein: ENSMUSP00000131465
Gene: ENSMUSG00000021910

DomainStartEndE-ValueType
low complexity region 231 249 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000170253
AA Change: F120I
SMART Domains Protein: ENSMUSP00000129547
Gene: ENSMUSG00000021910
AA Change: F120I

DomainStartEndE-ValueType
SCOP:d1dcea3 2 86 3e-11 SMART
Blast:LRR 13 34 1e-5 BLAST
Blast:LRR 35 60 1e-7 BLAST
Blast:LRR 60 86 2e-8 BLAST
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.4%
Validation Efficiency 100% (43/43)
MGI Phenotype PHENOTYPE: Mice homozygous for either a knock-out or hypomorphic allele exhibit hearing loss associated with increased susceptibility to otitis media. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2ml1 T C 6: 128,558,692 probably null Het
Birc6 C A 17: 74,662,779 H383Q probably damaging Het
C2 C A 17: 34,864,103 A431S probably benign Het
C3ar1 C T 6: 122,850,146 V371M probably damaging Het
Chd1l G A 3: 97,587,167 A399V probably damaging Het
Ckap2l A G 2: 129,285,494 S255P probably damaging Het
Clca3a1 T A 3: 144,730,797 I842F probably benign Het
Cmc2 G T 8: 116,894,157 H28Q probably damaging Het
Col11a2 C T 17: 34,043,317 P176L probably benign Het
Csmd3 T C 15: 47,881,387 D1404G probably damaging Het
Dld G A 12: 31,332,191 P506S probably benign Het
Dsg3 T C 18: 20,539,870 M866T probably benign Het
Ehd1 T C 19: 6,298,345 I451T possibly damaging Het
Fosb T C 7: 19,307,227 T114A probably benign Het
Foxd4 T A 19: 24,900,834 M1L possibly damaging Het
Fstl5 T A 3: 76,707,801 I723N probably benign Het
Gm10549 C A 18: 33,464,305 probably benign Het
Gm11595 G A 11: 99,772,555 R100C unknown Het
Hdlbp A G 1: 93,429,464 S299P possibly damaging Het
Mast4 G A 13: 102,761,382 R650C probably damaging Het
Micu3 A G 8: 40,366,197 T306A probably benign Het
Mylk2 A G 2: 152,913,693 Q259R possibly damaging Het
Nfkbiz T C 16: 55,821,962 N31S probably damaging Het
Nudt17 T C 3: 96,707,764 probably benign Het
Olfr1389 A C 11: 49,431,001 H175P probably damaging Het
Olfr292 T C 7: 86,694,552 V32A probably benign Het
Olfr541 T C 7: 140,704,703 W151R probably damaging Het
Oprm1 A C 10: 6,830,063 I242L probably damaging Het
Otud6b A G 4: 14,826,496 probably benign Het
Pamr1 A T 2: 102,642,174 D606V probably damaging Het
Pcf11 T C 7: 92,659,609 probably benign Het
Pom121l2 T C 13: 21,982,332 S258P probably damaging Het
Rcsd1 T A 1: 165,655,834 D196V possibly damaging Het
Sbf2 C T 7: 110,441,552 R356Q probably damaging Het
Serpinf1 A G 11: 75,413,905 probably null Het
Slc22a30 T G 19: 8,335,722 probably benign Het
Strn4 G T 7: 16,816,459 S36I probably benign Het
Taar6 A G 10: 23,985,279 L123P probably damaging Het
Thbs1 G T 2: 118,112,656 R5L unknown Het
Timp3 T C 10: 86,345,786 Y174H probably benign Het
Trpm2 C T 10: 77,932,227 V813M probably damaging Het
Uox C T 3: 146,624,577 R163* probably null Het
Vcan A T 13: 89,704,832 S670T probably damaging Het
Vmn1r65 A T 7: 6,008,652 N194K possibly damaging Het
Other mutations in Nisch
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01782:Nisch APN 14 31176639 unclassified probably benign
IGL01934:Nisch APN 14 31176739 unclassified probably benign
IGL02201:Nisch APN 14 31187094 unclassified probably benign
IGL02964:Nisch APN 14 31180812 unclassified probably benign
IGL03340:Nisch APN 14 31173144 missense probably damaging 0.98
R0092:Nisch UTSW 14 31191453 unclassified probably benign
R0119:Nisch UTSW 14 31171924 missense probably damaging 1.00
R0196:Nisch UTSW 14 31203394 unclassified probably benign
R0299:Nisch UTSW 14 31171924 missense probably damaging 1.00
R0452:Nisch UTSW 14 31177464 utr 3 prime probably benign
R1529:Nisch UTSW 14 31180938 unclassified probably benign
R1643:Nisch UTSW 14 31173168 missense probably damaging 1.00
R1656:Nisch UTSW 14 31177271 unclassified probably benign
R1663:Nisch UTSW 14 31191521 unclassified probably benign
R1676:Nisch UTSW 14 31180902 unclassified probably benign
R1750:Nisch UTSW 14 31174882 unclassified probably benign
R1799:Nisch UTSW 14 31177271 unclassified probably benign
R1824:Nisch UTSW 14 31176432 unclassified probably benign
R1876:Nisch UTSW 14 31173637 missense probably damaging 1.00
R2107:Nisch UTSW 14 31172140 missense probably damaging 0.99
R2117:Nisch UTSW 14 31177285 unclassified probably benign
R2276:Nisch UTSW 14 31176846 unclassified probably benign
R2402:Nisch UTSW 14 31185014 intron probably benign
R3703:Nisch UTSW 14 31176745 unclassified probably benign
R3704:Nisch UTSW 14 31176745 unclassified probably benign
R3705:Nisch UTSW 14 31176745 unclassified probably benign
R3897:Nisch UTSW 14 31191000 unclassified probably benign
R4024:Nisch UTSW 14 31176819 unclassified probably benign
R4412:Nisch UTSW 14 31186658 intron probably benign
R4752:Nisch UTSW 14 31192588 missense probably damaging 1.00
R4832:Nisch UTSW 14 31177630 utr 3 prime probably benign
R5009:Nisch UTSW 14 31187229 unclassified probably benign
R5043:Nisch UTSW 14 31176465 unclassified probably benign
R5062:Nisch UTSW 14 31172440 missense probably damaging 0.99
R5254:Nisch UTSW 14 31206567 splice site probably null
R5754:Nisch UTSW 14 31191416 unclassified probably benign
R5906:Nisch UTSW 14 31172028 intron probably null
R5930:Nisch UTSW 14 31173145 missense probably benign 0.11
R6246:Nisch UTSW 14 31172559 missense probably damaging 1.00
R6258:Nisch UTSW 14 31177128 unclassified probably benign
R6260:Nisch UTSW 14 31177128 unclassified probably benign
R6671:Nisch UTSW 14 31204463 unclassified probably benign
R6874:Nisch UTSW 14 31176684 unclassified probably benign
R6887:Nisch UTSW 14 31185344 unclassified probably benign
R7273:Nisch UTSW 14 31174407 missense unknown
R7401:Nisch UTSW 14 31206580 missense probably benign 0.18
R7423:Nisch UTSW 14 31171701 missense probably benign 0.09
R7822:Nisch UTSW 14 31174651 unclassified probably benign
R7870:Nisch UTSW 14 31172095 missense probably damaging 1.00
R7887:Nisch UTSW 14 31176695 nonsense probably null
R7953:Nisch UTSW 14 31172095 missense probably damaging 1.00
R7970:Nisch UTSW 14 31176695 nonsense probably null
X0027:Nisch UTSW 14 31187084 unclassified probably benign
Z1177:Nisch UTSW 14 31177438 frame shift probably null
Predicted Primers PCR Primer
(F):5'- GACAAAACAATGCTGGCGC -3'
(R):5'- ACAGTGGCAGGTGTTTGTCC -3'

Sequencing Primer
(F):5'- GTCTGACCATGCCACTTCAGAG -3'
(R):5'- CAGGTGTTTGTCCCCAGTGC -3'
Posted On2018-04-02