Mutagenetix > Incidental Mutation

Incidental Mutation 'R6327:Dsg3'

510494

Institutional Source

Beutler Lab

Gene Symbol

Dsg3

Ensembl Gene

ENSMUSG00000056632

Gene Name

desmoglein 3

Synonyms

MMRRC Submission

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.480) question?

Stock #

R6327 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

20510304-20541310 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 20539870 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Methionine to Threonine at position 866 (M866T)

Ref Sequence

ENSEMBL: ENSMUSP00000064718 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000070892]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000070892
AA Change: M866T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000064718
Gene: ENSMUSG00000056632
AA Change: M866T

Domain	Start	End	E-Value	Type
signal peptide	1	23	N/A	INTRINSIC
CA	70	155	3.9e-13	SMART
CA	179	265	2.36e-21	SMART
CA	288	382	1.55e-7	SMART
CA	409	493	6.15e-11	SMART
low complexity region	615	638	N/A	INTRINSIC
low complexity region	643	657	N/A	INTRINSIC
low complexity region	725	736	N/A	INTRINSIC

Meta Mutation Damage Score

0.0846

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.5%
20x: 98.4%

Validation Efficiency

100% (43/43)

MGI Phenotype

FUNCTION: This gene encodes a member of the cadherin family of proteins that forms an integral transmembrane component of desmosomes, the multiprotein complexes involved in cell adhesion, organization of the cytoskeleton, cell sorting and cell signaling. The encoded preproprotein undergoes proteolytic processing to generate a mature, functional protein. Mice lacking the encoded protein exhibit loss of keratinocyte cell adhesion resulting in a phenotype that resembles that of patients with pemphigus vulgaris. This gene is located in a cluster of desmosomal cadherin genes on chromosome 18. [provided by RefSeq, Feb 2016]
PHENOTYPE: Homozygous mutants display runting from decreased food intake due to oropharyngeal epithelial lesions, blisters around snout and eyes, hair loss by weaning, and hair regrowth with bald patches throughout life. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 44 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A2ml1	T	C	6: 128,558,692		probably null	Het
Birc6	C	A	17: 74,662,779	H383Q	probably damaging	Het
C2	C	A	17: 34,864,103	A431S	probably benign	Het
C3ar1	C	T	6: 122,850,146	V371M	probably damaging	Het
Chd1l	G	A	3: 97,587,167	A399V	probably damaging	Het
Ckap2l	A	G	2: 129,285,494	S255P	probably damaging	Het
Clca3a1	T	A	3: 144,730,797	I842F	probably benign	Het
Cmc2	G	T	8: 116,894,157	H28Q	probably damaging	Het
Col11a2	C	T	17: 34,043,317	P176L	probably benign	Het
Csmd3	T	C	15: 47,881,387	D1404G	probably damaging	Het
Dld	G	A	12: 31,332,191	P506S	probably benign	Het
Ehd1	T	C	19: 6,298,345	I451T	possibly damaging	Het
Fosb	T	C	7: 19,307,227	T114A	probably benign	Het
Foxd4	T	A	19: 24,900,834	M1L	possibly damaging	Het
Fstl5	T	A	3: 76,707,801	I723N	probably benign	Het
Gm10549	C	A	18: 33,464,305		probably benign	Het
Gm11595	G	A	11: 99,772,555	R100C	unknown	Het
Hdlbp	A	G	1: 93,429,464	S299P	possibly damaging	Het
Mast4	G	A	13: 102,761,382	R650C	probably damaging	Het
Micu3	A	G	8: 40,366,197	T306A	probably benign	Het
Mylk2	A	G	2: 152,913,693	Q259R	possibly damaging	Het
Nfkbiz	T	C	16: 55,821,962	N31S	probably damaging	Het
Nisch	A	T	14: 31,171,487		probably benign	Het
Nudt17	T	C	3: 96,707,764		probably benign	Het
Olfr1389	A	C	11: 49,431,001	H175P	probably damaging	Het
Olfr292	T	C	7: 86,694,552	V32A	probably benign	Het
Olfr541	T	C	7: 140,704,703	W151R	probably damaging	Het
Oprm1	A	C	10: 6,830,063	I242L	probably damaging	Het
Otud6b	A	G	4: 14,826,496		probably benign	Het
Pamr1	A	T	2: 102,642,174	D606V	probably damaging	Het
Pcf11	T	C	7: 92,659,609		probably benign	Het
Pom121l2	T	C	13: 21,982,332	S258P	probably damaging	Het
Rcsd1	T	A	1: 165,655,834	D196V	possibly damaging	Het
Sbf2	C	T	7: 110,441,552	R356Q	probably damaging	Het
Serpinf1	A	G	11: 75,413,905		probably null	Het
Slc22a30	T	G	19: 8,335,722		probably benign	Het
Strn4	G	T	7: 16,816,459	S36I	probably benign	Het
Taar6	A	G	10: 23,985,279	L123P	probably damaging	Het
Thbs1	G	T	2: 118,112,656	R5L	unknown	Het
Timp3	T	C	10: 86,345,786	Y174H	probably benign	Het
Trpm2	C	T	10: 77,932,227	V813M	probably damaging	Het
Uox	C	T	3: 146,624,577	R163*	probably null	Het
Vcan	A	T	13: 89,704,832	S670T	probably damaging	Het
Vmn1r65	A	T	7: 6,008,652	N194K	possibly damaging	Het

Other mutations in Dsg3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00587:Dsg3	APN	18	20539654	missense	probably damaging	1.00
IGL00697:Dsg3	APN	18	20524689	critical splice donor site	probably null
IGL00966:Dsg3	APN	18	20523607	missense	probably benign	0.02
IGL01352:Dsg3	APN	18	20523696	missense	probably benign	0.25
IGL01953:Dsg3	APN	18	20525304	missense	probably damaging	1.00
IGL02385:Dsg3	APN	18	20527714	missense	probably damaging	1.00
IGL02622:Dsg3	APN	18	20528947	splice site	probably benign
IGL02643:Dsg3	APN	18	20528955	missense	probably benign	0.00
IGL02740:Dsg3	APN	18	20527708	missense	possibly damaging	0.93
IGL03012:Dsg3	APN	18	20537243	critical splice acceptor site	probably null
IGL03026:Dsg3	APN	18	20536972	splice site	probably null
IGL03063:Dsg3	APN	18	20533368	splice site	probably benign
IGL03098:Dsg3	APN	18	20510365	utr 5 prime	probably benign
IGL03132:Dsg3	APN	18	20524596	missense	probably damaging	1.00
IGL03352:Dsg3	APN	18	20527632	missense	probably benign
P0035:Dsg3	UTSW	18	20539969	missense	probably benign	0.05
R0039:Dsg3	UTSW	18	20521484	missense	probably benign	0.36
R0099:Dsg3	UTSW	18	20540022	missense	probably benign	0.01
R0109:Dsg3	UTSW	18	20540134	missense	probably damaging	0.96
R0109:Dsg3	UTSW	18	20540134	missense	probably damaging	0.96
R0143:Dsg3	UTSW	18	20536825	missense	probably damaging	1.00
R0194:Dsg3	UTSW	18	20540142	missense	probably damaging	1.00
R0373:Dsg3	UTSW	18	20539747	missense	probably damaging	1.00
R0517:Dsg3	UTSW	18	20529025	missense	probably benign	0.06
R0521:Dsg3	UTSW	18	20527815	missense	possibly damaging	0.53
R1194:Dsg3	UTSW	18	20525220	missense	probably damaging	0.98
R1551:Dsg3	UTSW	18	20536918	missense	possibly damaging	0.84
R1762:Dsg3	UTSW	18	20539732	missense	probably damaging	1.00
R1957:Dsg3	UTSW	18	20522105	missense	probably damaging	1.00
R2061:Dsg3	UTSW	18	20527737	nonsense	probably null
R2071:Dsg3	UTSW	18	20536825	missense	probably damaging	1.00
R2513:Dsg3	UTSW	18	20523662	missense	possibly damaging	0.48
R2571:Dsg3	UTSW	18	20540005	missense	probably benign	0.01
R2945:Dsg3	UTSW	18	20539935	missense	probably benign
R2968:Dsg3	UTSW	18	20525225	missense	possibly damaging	0.75
R3906:Dsg3	UTSW	18	20538499	missense	probably damaging	1.00
R4616:Dsg3	UTSW	18	20531559	missense	probably benign
R4641:Dsg3	UTSW	18	20520558	missense	probably benign	0.28
R4685:Dsg3	UTSW	18	20539736	missense	probably benign	0.08
R5690:Dsg3	UTSW	18	20522051	missense	probably benign	0.01
R5786:Dsg3	UTSW	18	20521571	missense	possibly damaging	0.46
R5950:Dsg3	UTSW	18	20538529	missense	probably damaging	1.00
R6131:Dsg3	UTSW	18	20538512	missense	probably damaging	0.99
R6131:Dsg3	UTSW	18	20520477	splice site	probably null
R6243:Dsg3	UTSW	18	20539724	missense	probably damaging	1.00
R6315:Dsg3	UTSW	18	20524586	missense	probably benign	0.08
R6418:Dsg3	UTSW	18	20523760	critical splice donor site	probably null
R6464:Dsg3	UTSW	18	20533526	missense	probably benign	0.00
R6497:Dsg3	UTSW	18	20537248	missense	probably benign	0.33
R6518:Dsg3	UTSW	18	20533422	missense	probably benign	0.23
R6551:Dsg3	UTSW	18	20539911	missense	unknown
R6685:Dsg3	UTSW	18	20520615	critical splice donor site	probably null
R6952:Dsg3	UTSW	18	20525159	missense	possibly damaging	0.77
R7357:Dsg3	UTSW	18	20539783	missense	probably damaging	1.00
R7385:Dsg3	UTSW	18	20540197	missense	possibly damaging	0.52
R7456:Dsg3	UTSW	18	20531363	missense	probably benign	0.17
R7506:Dsg3	UTSW	18	20533464	missense	probably benign	0.31
R7570:Dsg3	UTSW	18	20527780	missense	possibly damaging	0.95
R7980:Dsg3	UTSW	18	20531360	missense	probably benign	0.00
R8100:Dsg3	UTSW	18	20528971	missense	probably benign	0.08
R8147:Dsg3	UTSW	18	20540073	missense	probably benign
R8242:Dsg3	UTSW	18	20536923	missense	possibly damaging	0.93
R8415:Dsg3	UTSW	18	20523708	missense	probably damaging	1.00
R8494:Dsg3	UTSW	18	20540214	missense	probably benign	0.03
R8930:Dsg3	UTSW	18	20539661	missense	probably damaging	1.00
R8932:Dsg3	UTSW	18	20539661	missense	probably damaging	1.00
R8998:Dsg3	UTSW	18	20533627	missense	probably damaging	1.00
R8999:Dsg3	UTSW	18	20533627	missense	probably damaging	1.00
R9336:Dsg3	UTSW	18	20524685	missense	probably benign	0.19
R9498:Dsg3	UTSW	18	20525221	missense	probably damaging	0.98
R9598:Dsg3	UTSW	18	20539732	missense	probably damaging	1.00
R9601:Dsg3	UTSW	18	20533521	missense	probably damaging	1.00
R9748:Dsg3	UTSW	18	20539704	missense	possibly damaging	0.87
R9794:Dsg3	UTSW	18	20540097	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- GCTGATCTACGATGATGAAGGC -3'
(R):5'- AGCAAGTAGTTCCCAAGCTG -3'

Sequencing Primer
(F):5'- TGAAGGCGAGGATGCTGCC -3'
(R):5'- TTCCCAAGCTGTAGAGGGTCAG -3'

Posted On

2018-04-02