Incidental Mutation 'R6327:Ehd1'
ID 510495
Institutional Source Beutler Lab
Gene Symbol Ehd1
Ensembl Gene ENSMUSG00000024772
Gene Name EH-domain containing 1
Synonyms RME-1, Past1
MMRRC Submission
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R6327 (G1)
Quality Score 225.009
Status Validated
Chromosome 19
Chromosomal Location 6276725-6300096 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 6298345 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Threonine at position 451 (I451T)
Ref Sequence ENSEMBL: ENSMUSP00000025684 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025684]
AlphaFold Q9WVK4
Predicted Effect possibly damaging
Transcript: ENSMUST00000025684
AA Change: I451T

PolyPhen 2 Score 0.811 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000025684
Gene: ENSMUSG00000024772
AA Change: I451T

DomainStartEndE-ValueType
Pfam:EHD_N 24 56 1.2e-19 PFAM
Pfam:MMR_HSR1 60 220 5.1e-9 PFAM
Pfam:Dynamin_N 61 221 6.6e-15 PFAM
low complexity region 420 433 N/A INTRINSIC
EH 438 531 1.82e-45 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148547
Predicted Effect noncoding transcript
Transcript: ENSMUST00000171203
Meta Mutation Damage Score 0.3267 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.4%
Validation Efficiency 100% (43/43)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to a highly conserved gene family encoding EPS15 homology (EH) domain-containing proteins. The protein-binding EH domain was first noted in EPS15, a substrate for the epidermal growth factor receptor. The EH domain has been shown to be an important motif in proteins involved in protein-protein interactions and in intracellular sorting. The protein encoded by this gene is thought to play a role in the endocytosis of IGF1 receptors. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Sep 2013]
PHENOTYPE: Mice homozygous for a knock-out allele show perinatal and postnatal lethality, decreased body weight, and male infertility due to defective spermatogenesis; female homozygotes may display malocclusion and variable ocular defects, including congenital central cataracts. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2ml1 T C 6: 128,558,692 probably null Het
Birc6 C A 17: 74,662,779 H383Q probably damaging Het
C2 C A 17: 34,864,103 A431S probably benign Het
C3ar1 C T 6: 122,850,146 V371M probably damaging Het
Chd1l G A 3: 97,587,167 A399V probably damaging Het
Ckap2l A G 2: 129,285,494 S255P probably damaging Het
Clca3a1 T A 3: 144,730,797 I842F probably benign Het
Cmc2 G T 8: 116,894,157 H28Q probably damaging Het
Col11a2 C T 17: 34,043,317 P176L probably benign Het
Csmd3 T C 15: 47,881,387 D1404G probably damaging Het
Dld G A 12: 31,332,191 P506S probably benign Het
Dsg3 T C 18: 20,539,870 M866T probably benign Het
Fosb T C 7: 19,307,227 T114A probably benign Het
Foxd4 T A 19: 24,900,834 M1L possibly damaging Het
Fstl5 T A 3: 76,707,801 I723N probably benign Het
Gm10549 C A 18: 33,464,305 probably benign Het
Gm11595 G A 11: 99,772,555 R100C unknown Het
Hdlbp A G 1: 93,429,464 S299P possibly damaging Het
Mast4 G A 13: 102,761,382 R650C probably damaging Het
Micu3 A G 8: 40,366,197 T306A probably benign Het
Mylk2 A G 2: 152,913,693 Q259R possibly damaging Het
Nfkbiz T C 16: 55,821,962 N31S probably damaging Het
Nisch A T 14: 31,171,487 probably benign Het
Nudt17 T C 3: 96,707,764 probably benign Het
Olfr1389 A C 11: 49,431,001 H175P probably damaging Het
Olfr292 T C 7: 86,694,552 V32A probably benign Het
Olfr541 T C 7: 140,704,703 W151R probably damaging Het
Oprm1 A C 10: 6,830,063 I242L probably damaging Het
Otud6b A G 4: 14,826,496 probably benign Het
Pamr1 A T 2: 102,642,174 D606V probably damaging Het
Pcf11 T C 7: 92,659,609 probably benign Het
Pom121l2 T C 13: 21,982,332 S258P probably damaging Het
Rcsd1 T A 1: 165,655,834 D196V possibly damaging Het
Sbf2 C T 7: 110,441,552 R356Q probably damaging Het
Serpinf1 A G 11: 75,413,905 probably null Het
Slc22a30 T G 19: 8,335,722 probably benign Het
Strn4 G T 7: 16,816,459 S36I probably benign Het
Taar6 A G 10: 23,985,279 L123P probably damaging Het
Thbs1 G T 2: 118,112,656 R5L unknown Het
Timp3 T C 10: 86,345,786 Y174H probably benign Het
Trpm2 C T 10: 77,932,227 V813M probably damaging Het
Uox C T 3: 146,624,577 R163* probably null Het
Vcan A T 13: 89,704,832 S670T probably damaging Het
Vmn1r65 A T 7: 6,008,652 N194K possibly damaging Het
Other mutations in Ehd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01109:Ehd1 APN 19 6298147 missense possibly damaging 0.86
IGL02573:Ehd1 APN 19 6294300 missense probably damaging 1.00
IGL03146:Ehd1 APN 19 6277338 missense probably damaging 1.00
declining UTSW 19 6294388 missense probably damaging 1.00
R1376:Ehd1 UTSW 19 6294388 missense probably damaging 1.00
R1376:Ehd1 UTSW 19 6294388 missense probably damaging 1.00
R1593:Ehd1 UTSW 19 6298300 missense
R2062:Ehd1 UTSW 19 6298078 missense probably benign 0.11
R2064:Ehd1 UTSW 19 6298078 missense probably benign 0.11
R2065:Ehd1 UTSW 19 6298078 missense probably benign 0.11
R2066:Ehd1 UTSW 19 6298078 missense probably benign 0.11
R2067:Ehd1 UTSW 19 6298078 missense probably benign 0.11
R2068:Ehd1 UTSW 19 6298078 missense probably benign 0.11
R2217:Ehd1 UTSW 19 6298472 missense probably damaging 1.00
R3436:Ehd1 UTSW 19 6277014 nonsense probably null
R3705:Ehd1 UTSW 19 6298300 missense
R4654:Ehd1 UTSW 19 6276964 utr 5 prime probably benign
R4902:Ehd1 UTSW 19 6294243 missense possibly damaging 0.91
R5001:Ehd1 UTSW 19 6297694 missense probably benign 0.14
R5076:Ehd1 UTSW 19 6277221 missense probably benign 0.02
R6679:Ehd1 UTSW 19 6294444 missense probably benign 0.01
R7120:Ehd1 UTSW 19 6297561 missense probably benign 0.00
R7183:Ehd1 UTSW 19 6297654 missense probably benign 0.02
R7215:Ehd1 UTSW 19 6297642 missense possibly damaging 0.81
R7853:Ehd1 UTSW 19 6277195 missense probably damaging 0.99
R8467:Ehd1 UTSW 19 6281288 missense probably benign 0.24
R8523:Ehd1 UTSW 19 6294583 missense probably damaging 0.98
R8879:Ehd1 UTSW 19 6298324 missense probably damaging 0.97
R8957:Ehd1 UTSW 19 6294409 missense probably damaging 1.00
R9011:Ehd1 UTSW 19 6298078 missense probably benign 0.11
R9664:Ehd1 UTSW 19 6281232 missense probably benign 0.01
R9687:Ehd1 UTSW 19 6298300 missense
Predicted Primers PCR Primer
(F):5'- CAAGTTCCAGGCCTTGAAGC -3'
(R):5'- CCTTGATAAGGTGGTTGGCC -3'

Sequencing Primer
(F):5'- TATGCTGGCCAACGATATAGCTCG -3'
(R):5'- TTGGCCAGGGCAAACTC -3'
Posted On 2018-04-02