Incidental Mutation 'R6327:Slc22a30'
ID510496
Institutional Source Beutler Lab
Gene Symbol Slc22a30
Ensembl Gene ENSMUSG00000052562
Gene Namesolute carrier family 22, member 30
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.086) question?
Stock #R6327 (G1)
Quality Score225.009
Status Validated
Chromosome19
Chromosomal Location8335371-8405111 bp(-) (GRCm38)
Type of Mutationutr 3 prime
DNA Base Change (assembly) T to G at 8335722 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000093988 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064507] [ENSMUST00000096269]
Predicted Effect unknown
Transcript: ENSMUST00000064507
AA Change: N462T
SMART Domains Protein: ENSMUSP00000069461
Gene: ENSMUSG00000052562
AA Change: N462T

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
Pfam:Sugar_tr 99 439 3.1e-21 PFAM
Pfam:MFS_1 127 433 8.8e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000096269
SMART Domains Protein: ENSMUSP00000093988
Gene: ENSMUSG00000052562

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
Pfam:Sugar_tr 99 527 9.6e-27 PFAM
Pfam:MFS_1 140 376 1.2e-15 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.4%
Validation Efficiency 100% (43/43)
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2ml1 T C 6: 128,558,692 probably null Het
Birc6 C A 17: 74,662,779 H383Q probably damaging Het
C2 C A 17: 34,864,103 A431S probably benign Het
C3ar1 C T 6: 122,850,146 V371M probably damaging Het
Chd1l G A 3: 97,587,167 A399V probably damaging Het
Ckap2l A G 2: 129,285,494 S255P probably damaging Het
Clca3a1 T A 3: 144,730,797 I842F probably benign Het
Cmc2 G T 8: 116,894,157 H28Q probably damaging Het
Col11a2 C T 17: 34,043,317 P176L probably benign Het
Csmd3 T C 15: 47,881,387 D1404G probably damaging Het
Dld G A 12: 31,332,191 P506S probably benign Het
Dsg3 T C 18: 20,539,870 M866T probably benign Het
Ehd1 T C 19: 6,298,345 I451T possibly damaging Het
Fosb T C 7: 19,307,227 T114A probably benign Het
Foxd4 T A 19: 24,900,834 M1L possibly damaging Het
Fstl5 T A 3: 76,707,801 I723N probably benign Het
Gm10549 C A 18: 33,464,305 probably benign Het
Gm11595 G A 11: 99,772,555 R100C unknown Het
Hdlbp A G 1: 93,429,464 S299P possibly damaging Het
Mast4 G A 13: 102,761,382 R650C probably damaging Het
Micu3 A G 8: 40,366,197 T306A probably benign Het
Mylk2 A G 2: 152,913,693 Q259R possibly damaging Het
Nfkbiz T C 16: 55,821,962 N31S probably damaging Het
Nisch A T 14: 31,171,487 probably benign Het
Nudt17 T C 3: 96,707,764 probably benign Het
Olfr1389 A C 11: 49,431,001 H175P probably damaging Het
Olfr292 T C 7: 86,694,552 V32A probably benign Het
Olfr541 T C 7: 140,704,703 W151R probably damaging Het
Oprm1 A C 10: 6,830,063 I242L probably damaging Het
Otud6b A G 4: 14,826,496 probably benign Het
Pamr1 A T 2: 102,642,174 D606V probably damaging Het
Pcf11 T C 7: 92,659,609 probably benign Het
Pom121l2 T C 13: 21,982,332 S258P probably damaging Het
Rcsd1 T A 1: 165,655,834 D196V possibly damaging Het
Sbf2 C T 7: 110,441,552 R356Q probably damaging Het
Serpinf1 A G 11: 75,413,905 probably null Het
Strn4 G T 7: 16,816,459 S36I probably benign Het
Taar6 A G 10: 23,985,279 L123P probably damaging Het
Thbs1 G T 2: 118,112,656 R5L unknown Het
Timp3 T C 10: 86,345,786 Y174H probably benign Het
Trpm2 C T 10: 77,932,227 V813M probably damaging Het
Uox C T 3: 146,624,577 R163* probably null Het
Vcan A T 13: 89,704,832 S670T probably damaging Het
Vmn1r65 A T 7: 6,008,652 N194K possibly damaging Het
Other mutations in Slc22a30
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00950:Slc22a30 APN 19 8335788 missense probably benign 0.29
IGL01894:Slc22a30 APN 19 8386657 missense probably benign 0.28
IGL02795:Slc22a30 APN 19 8400895 missense probably damaging 1.00
IGL02798:Slc22a30 APN 19 8370085 missense probably damaging 0.96
IGL03267:Slc22a30 APN 19 8337958 missense probably benign 0.00
R0089:Slc22a30 UTSW 19 8370197 missense probably benign 0.03
R0243:Slc22a30 UTSW 19 8345357 missense probably benign 0.01
R1033:Slc22a30 UTSW 19 8335801 nonsense probably null
R1781:Slc22a30 UTSW 19 8335772 missense probably damaging 1.00
R2098:Slc22a30 UTSW 19 8400811 missense probably damaging 1.00
R3874:Slc22a30 UTSW 19 8336849 missense probably benign 0.31
R4091:Slc22a30 UTSW 19 8404545 missense probably damaging 1.00
R4799:Slc22a30 UTSW 19 8344404 missense probably benign
R5108:Slc22a30 UTSW 19 8386426 missense probably damaging 1.00
R5191:Slc22a30 UTSW 19 8344393 nonsense probably null
R5192:Slc22a30 UTSW 19 8344393 nonsense probably null
R5193:Slc22a30 UTSW 19 8344393 nonsense probably null
R5195:Slc22a30 UTSW 19 8344393 nonsense probably null
R5253:Slc22a30 UTSW 19 8344393 nonsense probably null
R5254:Slc22a30 UTSW 19 8344393 nonsense probably null
R5255:Slc22a30 UTSW 19 8344393 nonsense probably null
R5256:Slc22a30 UTSW 19 8344393 nonsense probably null
R5377:Slc22a30 UTSW 19 8344393 nonsense probably null
R5378:Slc22a30 UTSW 19 8344393 nonsense probably null
R5400:Slc22a30 UTSW 19 8344393 nonsense probably null
R5401:Slc22a30 UTSW 19 8344393 nonsense probably null
R5481:Slc22a30 UTSW 19 8336837 missense probably benign 0.01
R5644:Slc22a30 UTSW 19 8404616 missense possibly damaging 0.72
R5679:Slc22a30 UTSW 19 8335771 missense possibly damaging 0.90
R5699:Slc22a30 UTSW 19 8344393 nonsense probably null
R5704:Slc22a30 UTSW 19 8344393 nonsense probably null
R5706:Slc22a30 UTSW 19 8344393 nonsense probably null
R5767:Slc22a30 UTSW 19 8344393 nonsense probably null
R5770:Slc22a30 UTSW 19 8386527 missense probably damaging 0.99
R5784:Slc22a30 UTSW 19 8344393 nonsense probably null
R5793:Slc22a30 UTSW 19 8336819 missense possibly damaging 0.95
R5813:Slc22a30 UTSW 19 8404581 missense probably benign 0.07
R6101:Slc22a30 UTSW 19 8337868 splice site probably null
R6105:Slc22a30 UTSW 19 8337868 splice site probably null
R6958:Slc22a30 UTSW 19 8386701 missense probably damaging 0.98
R7162:Slc22a30 UTSW 19 8336717 splice site probably null
R7375:Slc22a30 UTSW 19 8404691 missense probably damaging 1.00
R7572:Slc22a30 UTSW 19 8335708 missense unknown
R7755:Slc22a30 UTSW 19 8336769 missense probably damaging 1.00
Z1088:Slc22a30 UTSW 19 8335775 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATGTCAAGCAGGATTTCTTTCCATG -3'
(R):5'- CATTGTTTCAAAGGTGATGGGTGAAAG -3'

Sequencing Primer
(F):5'- GCAGGATTTCTTTCCATGTACTTTTC -3'
(R):5'- GTCCTAGTTGGAAAGAGTCA -3'
Posted On2018-04-02