Incidental Mutation 'R6327:Slc22a30'
ID 510496
Institutional Source Beutler Lab
Gene Symbol Slc22a30
Ensembl Gene ENSMUSG00000052562
Gene Name solute carrier family 22, member 30
Synonyms C730048C13Rik
MMRRC Submission 044481-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.074) question?
Stock # R6327 (G1)
Quality Score 225.009
Status Validated
Chromosome 19
Chromosomal Location 8312735-8382475 bp(-) (GRCm39)
Type of Mutation utr 3 prime
DNA Base Change (assembly) T to G at 8313086 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000093988 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064507] [ENSMUST00000096269]
AlphaFold Q96LX3
Predicted Effect unknown
Transcript: ENSMUST00000064507
AA Change: N462T
SMART Domains Protein: ENSMUSP00000069461
Gene: ENSMUSG00000052562
AA Change: N462T

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
Pfam:Sugar_tr 99 439 3.1e-21 PFAM
Pfam:MFS_1 127 433 8.8e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000096269
SMART Domains Protein: ENSMUSP00000093988
Gene: ENSMUSG00000052562

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
Pfam:Sugar_tr 99 527 9.6e-27 PFAM
Pfam:MFS_1 140 376 1.2e-15 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.4%
Validation Efficiency 100% (43/43)
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2ml1 T C 6: 128,535,655 (GRCm39) probably null Het
Birc6 C A 17: 74,969,774 (GRCm39) H383Q probably damaging Het
C2 C A 17: 35,083,079 (GRCm39) A431S probably benign Het
C3ar1 C T 6: 122,827,105 (GRCm39) V371M probably damaging Het
Chd1l G A 3: 97,494,483 (GRCm39) A399V probably damaging Het
Ckap2l A G 2: 129,127,414 (GRCm39) S255P probably damaging Het
Clca3a1 T A 3: 144,436,558 (GRCm39) I842F probably benign Het
Cmc2 G T 8: 117,620,896 (GRCm39) H28Q probably damaging Het
Col11a2 C T 17: 34,262,291 (GRCm39) P176L probably benign Het
Csmd3 T C 15: 47,744,783 (GRCm39) D1404G probably damaging Het
Dld G A 12: 31,382,190 (GRCm39) P506S probably benign Het
Dsg3 T C 18: 20,672,927 (GRCm39) M866T probably benign Het
Ehd1 T C 19: 6,348,375 (GRCm39) I451T possibly damaging Het
Fosb T C 7: 19,041,152 (GRCm39) T114A probably benign Het
Foxd4 T A 19: 24,878,198 (GRCm39) M1L possibly damaging Het
Fstl5 T A 3: 76,615,108 (GRCm39) I723N probably benign Het
Gm10549 C A 18: 33,597,358 (GRCm39) probably benign Het
Gm11595 G A 11: 99,663,381 (GRCm39) R100C unknown Het
Hdlbp A G 1: 93,357,186 (GRCm39) S299P possibly damaging Het
Mast4 G A 13: 102,897,890 (GRCm39) R650C probably damaging Het
Micu3 A G 8: 40,819,238 (GRCm39) T306A probably benign Het
Mylk2 A G 2: 152,755,613 (GRCm39) Q259R possibly damaging Het
Nfkbiz T C 16: 55,642,325 (GRCm39) N31S probably damaging Het
Nisch A T 14: 30,893,444 (GRCm39) probably benign Het
Nudt17 T C 3: 96,615,080 (GRCm39) probably benign Het
Oprm1 A C 10: 6,780,063 (GRCm39) I242L probably damaging Het
Or13a26 T C 7: 140,284,616 (GRCm39) W151R probably damaging Het
Or14c39 T C 7: 86,343,760 (GRCm39) V32A probably benign Het
Or2y1d A C 11: 49,321,828 (GRCm39) H175P probably damaging Het
Otud6b A G 4: 14,826,496 (GRCm39) probably benign Het
Pamr1 A T 2: 102,472,519 (GRCm39) D606V probably damaging Het
Pcf11 T C 7: 92,308,817 (GRCm39) probably benign Het
Pom121l2 T C 13: 22,166,502 (GRCm39) S258P probably damaging Het
Rcsd1 T A 1: 165,483,403 (GRCm39) D196V possibly damaging Het
Sbf2 C T 7: 110,040,759 (GRCm39) R356Q probably damaging Het
Serpinf1 A G 11: 75,304,731 (GRCm39) probably null Het
Strn4 G T 7: 16,550,384 (GRCm39) S36I probably benign Het
Taar6 A G 10: 23,861,177 (GRCm39) L123P probably damaging Het
Thbs1 G T 2: 117,943,137 (GRCm39) R5L unknown Het
Timp3 T C 10: 86,181,650 (GRCm39) Y174H probably benign Het
Trpm2 C T 10: 77,768,061 (GRCm39) V813M probably damaging Het
Uox C T 3: 146,330,332 (GRCm39) R163* probably null Het
Vcan A T 13: 89,852,951 (GRCm39) S670T probably damaging Het
Vmn1r65 A T 7: 6,011,651 (GRCm39) N194K possibly damaging Het
Other mutations in Slc22a30
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00950:Slc22a30 APN 19 8,313,152 (GRCm39) missense probably benign 0.29
IGL01894:Slc22a30 APN 19 8,364,021 (GRCm39) missense probably benign 0.28
IGL02795:Slc22a30 APN 19 8,378,259 (GRCm39) missense probably damaging 1.00
IGL02798:Slc22a30 APN 19 8,347,449 (GRCm39) missense probably damaging 0.96
IGL03267:Slc22a30 APN 19 8,315,322 (GRCm39) missense probably benign 0.00
R0089:Slc22a30 UTSW 19 8,347,561 (GRCm39) missense probably benign 0.03
R0243:Slc22a30 UTSW 19 8,322,721 (GRCm39) missense probably benign 0.01
R1033:Slc22a30 UTSW 19 8,313,165 (GRCm39) nonsense probably null
R1781:Slc22a30 UTSW 19 8,313,136 (GRCm39) missense probably damaging 1.00
R2098:Slc22a30 UTSW 19 8,378,175 (GRCm39) missense probably damaging 1.00
R3874:Slc22a30 UTSW 19 8,314,213 (GRCm39) missense probably benign 0.31
R4091:Slc22a30 UTSW 19 8,381,909 (GRCm39) missense probably damaging 1.00
R4799:Slc22a30 UTSW 19 8,321,768 (GRCm39) missense probably benign
R5108:Slc22a30 UTSW 19 8,363,790 (GRCm39) missense probably damaging 1.00
R5191:Slc22a30 UTSW 19 8,321,757 (GRCm39) nonsense probably null
R5192:Slc22a30 UTSW 19 8,321,757 (GRCm39) nonsense probably null
R5193:Slc22a30 UTSW 19 8,321,757 (GRCm39) nonsense probably null
R5195:Slc22a30 UTSW 19 8,321,757 (GRCm39) nonsense probably null
R5253:Slc22a30 UTSW 19 8,321,757 (GRCm39) nonsense probably null
R5254:Slc22a30 UTSW 19 8,321,757 (GRCm39) nonsense probably null
R5255:Slc22a30 UTSW 19 8,321,757 (GRCm39) nonsense probably null
R5256:Slc22a30 UTSW 19 8,321,757 (GRCm39) nonsense probably null
R5377:Slc22a30 UTSW 19 8,321,757 (GRCm39) nonsense probably null
R5378:Slc22a30 UTSW 19 8,321,757 (GRCm39) nonsense probably null
R5400:Slc22a30 UTSW 19 8,321,757 (GRCm39) nonsense probably null
R5401:Slc22a30 UTSW 19 8,321,757 (GRCm39) nonsense probably null
R5481:Slc22a30 UTSW 19 8,314,201 (GRCm39) missense probably benign 0.01
R5644:Slc22a30 UTSW 19 8,381,980 (GRCm39) missense possibly damaging 0.72
R5679:Slc22a30 UTSW 19 8,313,135 (GRCm39) missense possibly damaging 0.90
R5699:Slc22a30 UTSW 19 8,321,757 (GRCm39) nonsense probably null
R5704:Slc22a30 UTSW 19 8,321,757 (GRCm39) nonsense probably null
R5706:Slc22a30 UTSW 19 8,321,757 (GRCm39) nonsense probably null
R5767:Slc22a30 UTSW 19 8,321,757 (GRCm39) nonsense probably null
R5770:Slc22a30 UTSW 19 8,363,891 (GRCm39) missense probably damaging 0.99
R5784:Slc22a30 UTSW 19 8,321,757 (GRCm39) nonsense probably null
R5793:Slc22a30 UTSW 19 8,314,183 (GRCm39) missense possibly damaging 0.95
R5813:Slc22a30 UTSW 19 8,381,945 (GRCm39) missense probably benign 0.07
R6101:Slc22a30 UTSW 19 8,315,232 (GRCm39) splice site probably null
R6105:Slc22a30 UTSW 19 8,315,232 (GRCm39) splice site probably null
R6958:Slc22a30 UTSW 19 8,364,065 (GRCm39) missense probably damaging 0.98
R7162:Slc22a30 UTSW 19 8,314,081 (GRCm39) splice site probably null
R7375:Slc22a30 UTSW 19 8,382,055 (GRCm39) missense probably damaging 1.00
R7572:Slc22a30 UTSW 19 8,313,072 (GRCm39) missense unknown
R7755:Slc22a30 UTSW 19 8,314,133 (GRCm39) missense probably damaging 1.00
R8114:Slc22a30 UTSW 19 8,381,904 (GRCm39) nonsense probably null
R8248:Slc22a30 UTSW 19 8,347,563 (GRCm39) missense probably benign 0.12
R8677:Slc22a30 UTSW 19 8,364,035 (GRCm39) missense probably benign 0.21
R8854:Slc22a30 UTSW 19 8,363,754 (GRCm39) critical splice donor site probably null
R8900:Slc22a30 UTSW 19 8,315,340 (GRCm39) missense probably damaging 1.00
R9185:Slc22a30 UTSW 19 8,321,917 (GRCm39) missense probably benign 0.03
R9296:Slc22a30 UTSW 19 8,364,119 (GRCm39) missense probably benign 0.06
R9463:Slc22a30 UTSW 19 8,378,259 (GRCm39) missense probably damaging 1.00
R9773:Slc22a30 UTSW 19 8,321,754 (GRCm39) missense probably benign 0.01
Z1088:Slc22a30 UTSW 19 8,313,139 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATGTCAAGCAGGATTTCTTTCCATG -3'
(R):5'- CATTGTTTCAAAGGTGATGGGTGAAAG -3'

Sequencing Primer
(F):5'- GCAGGATTTCTTTCCATGTACTTTTC -3'
(R):5'- GTCCTAGTTGGAAAGAGTCA -3'
Posted On 2018-04-02