Mutagenetix > Incidental Mutation

Incidental Mutation 'R6313:Rb1cc1'

510498

Institutional Source

Beutler Lab

Gene Symbol

Rb1cc1

Ensembl Gene

ENSMUSG00000025907

Gene Name

RB1-inducible coiled-coil 1

Synonyms

Cc1, 2900055E04Rik, LaXp180, 5930404L04Rik, Fip200

MMRRC Submission

044470-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R6313 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

6206197-6276648 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 6244133 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Methionine to Lysine at position 343 (M343K)

Ref Sequence

ENSEMBL: ENSMUSP00000027040 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000027040] [ENSMUST00000162795]

AlphaFold

Q9ESK9

Predicted Effect

probably benign
Transcript: ENSMUST00000027040
AA Change: M343K

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)

SMART Domains

Protein: ENSMUSP00000027040
Gene: ENSMUSG00000025907
AA Change: M343K

Domain	Start	End	E-Value	Type
SCOP:d1euvb_	1	51	7e-4	SMART
Blast:UBQ	3	76	8e-12	BLAST
low complexity region	471	486	N/A	INTRINSIC
low complexity region	643	653	N/A	INTRINSIC
low complexity region	658	674	N/A	INTRINSIC
coiled coil region	859	921	N/A	INTRINSIC
low complexity region	1033	1045	N/A	INTRINSIC
low complexity region	1055	1066	N/A	INTRINSIC
SCOP:d1eq1a_	1159	1305	1e-3	SMART
low complexity region	1374	1388	N/A	INTRINSIC
Pfam:ATG11	1447	1583	5.6e-28	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000159802

Predicted Effect

unknown
Transcript: ENSMUST00000161327
AA Change: M222K

SMART Domains

Protein: ENSMUSP00000125348
Gene: ENSMUSG00000025907
AA Change: M222K

Domain	Start	End	E-Value	Type
low complexity region	351	366	N/A	INTRINSIC
low complexity region	523	533	N/A	INTRINSIC
low complexity region	538	554	N/A	INTRINSIC
coiled coil region	738	800	N/A	INTRINSIC
low complexity region	913	925	N/A	INTRINSIC
low complexity region	935	946	N/A	INTRINSIC
SCOP:d1eq1a_	1039	1174	3e-3	SMART
low complexity region	1254	1268	N/A	INTRINSIC
Pfam:ATG11	1327	1463	6.7e-28	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000162257

SMART Domains

Protein: ENSMUSP00000125334
Gene: ENSMUSG00000025907

Domain	Start	End	E-Value	Type
coiled coil region	33	331	N/A	INTRINSIC
low complexity region	335	355	N/A	INTRINSIC
coiled coil region	363	483	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000162795
AA Change: M343K

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000124676
Gene: ENSMUSG00000025907
AA Change: M343K

Domain	Start	End	E-Value	Type
SCOP:d1euvb_	1	51	2e-4	SMART
Blast:UBQ	3	76	4e-12	BLAST
low complexity region	454	469	N/A	INTRINSIC
low complexity region	626	636	N/A	INTRINSIC
low complexity region	641	657	N/A	INTRINSIC
coiled coil region	842	865	N/A	INTRINSIC

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.5%
20x: 98.4%

Validation Efficiency

100% (70/70)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene interacts with signaling pathways to coordinately regulate cell growth, cell proliferation, apoptosis, autophagy, and cell migration. This tumor suppressor also enhances retinoblastoma 1 gene expression in cancer cells. Alternative splicing results in multiple transcript variants encoding distinct isoforms. [provided by RefSeq, Nov 2009]
PHENOTYPE: Homozygous mutation of this gene results in embryonic lethality at mid/late gestation associated with heart failure and liver degeneration. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 69 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1810046K07Rik	C	T	9: 51,290,181	D192N	probably damaging	Het
4932415D10Rik	T	C	10: 82,293,636	N1180S	probably benign	Het
Abca16	T	C	7: 120,527,121	F1167L	probably damaging	Het
Abraxas2	G	A	7: 132,874,965	A145T	probably damaging	Het
Acaca	C	T	11: 84,292,929	T32I	probably benign	Het
Adam6a	A	T	12: 113,545,050	N348Y	possibly damaging	Het
Ankdd1a	C	T	9: 65,508,061	A227T	possibly damaging	Het
Arhgef38	T	C	3: 133,234,708	D39G	possibly damaging	Het
Arid5b	T	C	10: 68,097,582	D587G	possibly damaging	Het
Brwd1	A	G	16: 96,007,941	V1963A	probably benign	Het
Ccdc136	T	A	6: 29,410,205	L34Q	probably damaging	Het
Cdh2	T	C	18: 16,774,522	Q53R	probably benign	Het
Celsr2	G	A	3: 108,401,214	S1799L	probably damaging	Het
Cenpe	A	G	3: 135,230,175	E457G	probably benign	Het
Cmtm1	A	T	8: 104,305,163	M283K	possibly damaging	Het
Dcdc5	T	C	2: 106,368,171		noncoding transcript	Het
Decr1	T	A	4: 15,924,261	M220L	probably benign	Het
Dgkg	T	G	16: 22,519,561	D592A	probably damaging	Het
Dkkl1	T	C	7: 45,211,438	Q39R	probably benign	Het
Dyrk1a	T	A	16: 94,659,514	C10S	possibly damaging	Het
Efcab2	A	T	1: 178,481,371	E146D	probably benign	Het
Efhc1	T	C	1: 20,979,428	V504A	possibly damaging	Het
Ermard	T	G	17: 15,053,205		probably null	Het
Espl1	T	C	15: 102,315,812	V1266A	probably benign	Het
Fbxw22	A	C	9: 109,403,397	V40G	probably damaging	Het
Gm3460	A	T	14: 6,619,410	I194N	possibly damaging	Het
Gnai2	C	T	9: 107,620,097	V33M	possibly damaging	Het
H2-DMb1	T	C	17: 34,157,532		probably null	Het
Hc	T	C	2: 34,989,839		probably null	Het
Iars	T	C	13: 49,708,445	S491P	probably damaging	Het
Knl1	T	A	2: 119,069,318	L500H	probably damaging	Het
Lamb1	A	T	12: 31,269,147	T102S	probably damaging	Het
Lrrc7	A	G	3: 158,160,736	S1123P	probably damaging	Het
Mettl5	C	A	2: 69,871,727		probably null	Het
Mmp11	A	G	10: 75,923,984	*4R	probably null	Het
Myom1	A	T	17: 71,082,488	D911V	probably benign	Het
Nid1	A	G	13: 13,463,782	T96A	probably benign	Het
Nlrp4e	G	T	7: 23,353,172	V839L	probably benign	Het
Notch3	A	T	17: 32,151,154		probably null	Het
Olfr1082	T	C	2: 86,594,067	T254A	possibly damaging	Het
Pcdh8	T	C	14: 79,767,651	H978R	probably benign	Het
Pde8b	A	T	13: 95,042,000	C537*	probably null	Het
Polr1b	T	C	2: 129,125,446	F920L	probably damaging	Het
Polr2f	A	G	15: 79,151,373	T87A	probably damaging	Het
Pon2	T	A	6: 5,272,421	H133L	probably damaging	Het
Ptk2b	T	A	14: 66,178,831	E205V	probably damaging	Het
Rlf	G	A	4: 121,148,610	R1058W	probably damaging	Het
S100z	T	A	13: 95,478,574	K28*	probably null	Het
Scarf1	T	A	11: 75,520,315	N273K	probably benign	Het
Setd2	A	G	9: 110,556,366	I136M	unknown	Het
Sfrp2	A	G	3: 83,766,984	D148G	probably benign	Het
Slc24a4	A	G	12: 102,254,510	E400G	probably benign	Het
Slc2a9	T	G	5: 38,453,121	I112L	probably benign	Het
Smc5	A	T	19: 23,208,948	Y972*	probably null	Het
Sntg1	T	C	1: 8,445,024		probably null	Het
Stag1	A	G	9: 100,757,733	D114G	probably damaging	Het
Suclg1	T	C	6: 73,256,209	S46P	probably damaging	Het
Synj1	C	T	16: 90,946,815	A1186T	probably benign	Het
Tas2r124	A	G	6: 132,755,447	T240A	probably benign	Het
Tax1bp1	T	C	6: 52,744,356		probably null	Het
Tchh	C	A	3: 93,447,851	Q1533K	unknown	Het
Tmprss15	T	C	16: 78,962,170	T887A	probably benign	Het
Ttn	T	C	2: 76,706,593	I34963V	probably benign	Het
Unc79	G	A	12: 103,112,619	G1485D	probably damaging	Het
Usp9y	G	T	Y: 1,385,355	H633N	probably benign	Homo
Vmn2r99	A	T	17: 19,382,605	N541Y	probably damaging	Het
Zbtb11	T	A	16: 55,990,491	N337K	probably benign	Het
Zfp260	T	A	7: 30,104,842	C56S	possibly damaging	Het
Zfp457	C	T	13: 67,292,682	E610K	probably damaging	Het

Other mutations in Rb1cc1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00489:Rb1cc1	APN	1	6249506	missense	probably damaging	0.97
IGL00590:Rb1cc1	APN	1	6238296	missense	probably damaging	1.00
IGL00678:Rb1cc1	APN	1	6234085	missense	probably damaging	1.00
IGL00705:Rb1cc1	APN	1	6244133	missense	probably benign	0.00
IGL00957:Rb1cc1	APN	1	6249539	missense	probably damaging	1.00
IGL01363:Rb1cc1	APN	1	6250109	missense	probably benign	0.06
IGL01599:Rb1cc1	APN	1	6248771	nonsense	probably null
IGL01610:Rb1cc1	APN	1	6248481	missense	probably benign	0.03
IGL01929:Rb1cc1	APN	1	6240159	missense	possibly damaging	0.82
IGL01978:Rb1cc1	APN	1	6238368	missense	probably damaging	1.00
IGL02312:Rb1cc1	APN	1	6265623	critical splice donor site	probably null
IGL02471:Rb1cc1	APN	1	6240051	missense	probably benign	0.01
IGL02677:Rb1cc1	APN	1	6249419	missense	probably benign
IGL02702:Rb1cc1	APN	1	6240023	missense	probably damaging	0.99
IGL02816:Rb1cc1	APN	1	6262828	splice site	probably benign
IGL02899:Rb1cc1	APN	1	6264583	missense	probably damaging	1.00
fingerling	UTSW	1	6261032	missense	probably damaging	1.00
tots	UTSW	1	6245637	missense	probably damaging	0.99
IGL02988:Rb1cc1	UTSW	1	6247811	critical splice donor site	probably null
R0020:Rb1cc1	UTSW	1	6264548	missense	possibly damaging	0.86
R0254:Rb1cc1	UTSW	1	6262847	missense	probably damaging	1.00
R0390:Rb1cc1	UTSW	1	6248634	missense	probably damaging	1.00
R0466:Rb1cc1	UTSW	1	6263267	splice site	probably null
R0482:Rb1cc1	UTSW	1	6240323	missense	probably damaging	1.00
R0510:Rb1cc1	UTSW	1	6249171	missense	probably benign	0.00
R0512:Rb1cc1	UTSW	1	6248543	missense	probably damaging	1.00
R0616:Rb1cc1	UTSW	1	6244262	missense	possibly damaging	0.80
R0617:Rb1cc1	UTSW	1	6248790	missense	possibly damaging	0.83
R0837:Rb1cc1	UTSW	1	6234271	splice site	probably null
R1399:Rb1cc1	UTSW	1	6249818	missense	probably benign	0.00
R1532:Rb1cc1	UTSW	1	6249734	missense	probably benign	0.00
R1542:Rb1cc1	UTSW	1	6244249	missense	possibly damaging	0.82
R1746:Rb1cc1	UTSW	1	6263013	splice site	probably null
R1764:Rb1cc1	UTSW	1	6214680	intron	probably benign
R1968:Rb1cc1	UTSW	1	6248195	splice site	probably null
R2025:Rb1cc1	UTSW	1	6245309	missense	probably damaging	1.00
R2076:Rb1cc1	UTSW	1	6250038	missense	possibly damaging	0.82
R2101:Rb1cc1	UTSW	1	6249335	missense	probably benign
R2249:Rb1cc1	UTSW	1	6272724	missense	probably damaging	1.00
R3176:Rb1cc1	UTSW	1	6249366	missense	probably benign
R3276:Rb1cc1	UTSW	1	6249366	missense	probably benign
R3716:Rb1cc1	UTSW	1	6270690	critical splice acceptor site	probably null
R3747:Rb1cc1	UTSW	1	6248742	missense	possibly damaging	0.92
R3850:Rb1cc1	UTSW	1	6250113	missense	probably benign	0.22
R3967:Rb1cc1	UTSW	1	6248270	splice site	probably benign
R3969:Rb1cc1	UTSW	1	6248270	splice site	probably benign
R3972:Rb1cc1	UTSW	1	6249000	missense	probably benign	0.00
R4166:Rb1cc1	UTSW	1	6265663	intron	probably benign
R4168:Rb1cc1	UTSW	1	6230024	missense	probably damaging	1.00
R4358:Rb1cc1	UTSW	1	6245637	missense	probably damaging	0.99
R4370:Rb1cc1	UTSW	1	6248547	missense	probably damaging	1.00
R4869:Rb1cc1	UTSW	1	6215021	intron	probably benign
R4945:Rb1cc1	UTSW	1	6249627	missense	probably benign	0.24
R5111:Rb1cc1	UTSW	1	6214634	intron	probably benign
R5175:Rb1cc1	UTSW	1	6248321	missense	probably benign
R5196:Rb1cc1	UTSW	1	6234230	missense	probably damaging	0.99
R5271:Rb1cc1	UTSW	1	6249193	nonsense	probably null
R5341:Rb1cc1	UTSW	1	6215042	intron	probably benign
R5952:Rb1cc1	UTSW	1	6248182	missense	probably benign
R5992:Rb1cc1	UTSW	1	6233996	missense	probably damaging	1.00
R6054:Rb1cc1	UTSW	1	6249834	missense	probably benign	0.01
R6064:Rb1cc1	UTSW	1	6249734	missense	probably benign	0.00
R6345:Rb1cc1	UTSW	1	6263257	missense	probably benign	0.00
R6488:Rb1cc1	UTSW	1	6270727	missense	probably damaging	0.97
R6566:Rb1cc1	UTSW	1	6249092	missense	probably benign	0.15
R6739:Rb1cc1	UTSW	1	6234230	missense	probably damaging	0.99
R6829:Rb1cc1	UTSW	1	6249264	missense	probably benign	0.04
R6945:Rb1cc1	UTSW	1	6261032	missense	probably damaging	1.00
R6976:Rb1cc1	UTSW	1	6262902	missense	probably benign	0.01
R7031:Rb1cc1	UTSW	1	6238466	critical splice donor site	probably null
R7066:Rb1cc1	UTSW	1	6250005	missense	possibly damaging	0.69
R7185:Rb1cc1	UTSW	1	6238383	missense	probably damaging	1.00
R7276:Rb1cc1	UTSW	1	6249192	missense	probably benign	0.13
R7448:Rb1cc1	UTSW	1	6245503	missense	probably damaging	1.00
R7463:Rb1cc1	UTSW	1	6249180	missense	probably benign
R7484:Rb1cc1	UTSW	1	6274217	missense	probably damaging	1.00
R7496:Rb1cc1	UTSW	1	6248191	missense	probably null	0.02
R7618:Rb1cc1	UTSW	1	6265558	splice site	probably null
R7681:Rb1cc1	UTSW	1	6240323	missense	probably damaging	1.00
R7774:Rb1cc1	UTSW	1	6248085	missense	possibly damaging	0.63
R7780:Rb1cc1	UTSW	1	6248914	nonsense	probably null
R7947:Rb1cc1	UTSW	1	6248562	missense	probably damaging	1.00
R8057:Rb1cc1	UTSW	1	6245219	missense	probably damaging	1.00
R8094:Rb1cc1	UTSW	1	6263224	nonsense	probably null
R8527:Rb1cc1	UTSW	1	6244875	missense	probably damaging	1.00
R8758:Rb1cc1	UTSW	1	6240227	missense	probably benign	0.10
R8843:Rb1cc1	UTSW	1	6245171	missense	probably damaging	1.00
R8922:Rb1cc1	UTSW	1	6248970	missense	probably benign
R8937:Rb1cc1	UTSW	1	6263217	missense	probably benign
R9018:Rb1cc1	UTSW	1	6249266	missense	probably benign
R9106:Rb1cc1	UTSW	1	6248885	missense
R9127:Rb1cc1	UTSW	1	6262849	missense	probably damaging	1.00
R9130:Rb1cc1	UTSW	1	6244885	missense	probably damaging	0.99
R9311:Rb1cc1	UTSW	1	6240315	missense	probably damaging	1.00
R9365:Rb1cc1	UTSW	1	6244893	missense	probably damaging	1.00
R9563:Rb1cc1	UTSW	1	6244115	missense	probably benign
R9598:Rb1cc1	UTSW	1	6239965	missense	probably damaging	1.00
R9608:Rb1cc1	UTSW	1	6248304	missense	probably benign	0.02
R9659:Rb1cc1	UTSW	1	6248449	missense	probably benign	0.33
R9799:Rb1cc1	UTSW	1	6244902	missense	probably damaging	1.00
Z1088:Rb1cc1	UTSW	1	6249018	frame shift	probably null

Predicted Primers

PCR Primer
(F):5'- GATGGGGTTCATCCTATTAATCTTCC -3'
(R):5'- AAATGAAATTCAGCTGCTTGCC -3'

Sequencing Primer
(F):5'- GGTTCATCCTATTAATCTTCCTTTGC -3'
(R):5'- CTTGCCTCTGGGAGCTAGAAATC -3'

Posted On

2018-04-02