Incidental Mutation 'R6313:Tchh'
ID510506
Institutional Source Beutler Lab
Gene Symbol Tchh
Ensembl Gene ENSMUSG00000052415
Gene Nametrichohyalin
SynonymsThh, AHF
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.089) question?
Stock #R6313 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location93442330-93449077 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 93447851 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Lysine at position 1533 (Q1533K)
Ref Sequence ENSEMBL: ENSMUSP00000069525 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064257]
Predicted Effect unknown
Transcript: ENSMUST00000064257
AA Change: Q1533K
SMART Domains Protein: ENSMUSP00000069525
Gene: ENSMUSG00000052415
AA Change: Q1533K

DomainStartEndE-ValueType
Pfam:S_100 4 46 3.5e-15 PFAM
Blast:EFh 53 81 4e-9 BLAST
low complexity region 110 123 N/A INTRINSIC
coiled coil region 137 370 N/A INTRINSIC
internal_repeat_2 374 384 2.35e-6 PROSPERO
internal_repeat_1 382 400 4.53e-15 PROSPERO
low complexity region 403 431 N/A INTRINSIC
internal_repeat_2 432 442 2.35e-6 PROSPERO
low complexity region 443 469 N/A INTRINSIC
low complexity region 480 494 N/A INTRINSIC
low complexity region 497 511 N/A INTRINSIC
coiled coil region 516 625 N/A INTRINSIC
internal_repeat_1 627 645 4.53e-15 PROSPERO
coiled coil region 661 700 N/A INTRINSIC
low complexity region 717 734 N/A INTRINSIC
coiled coil region 738 821 N/A INTRINSIC
low complexity region 827 844 N/A INTRINSIC
low complexity region 847 864 N/A INTRINSIC
low complexity region 867 905 N/A INTRINSIC
coiled coil region 927 1049 N/A INTRINSIC
coiled coil region 1073 1263 N/A INTRINSIC
coiled coil region 1295 1570 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000195137
Meta Mutation Damage Score 0.0849 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.4%
Validation Efficiency 100% (70/70)
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810046K07Rik C T 9: 51,290,181 D192N probably damaging Het
4932415D10Rik T C 10: 82,293,636 N1180S probably benign Het
Abca16 T C 7: 120,527,121 F1167L probably damaging Het
Abraxas2 G A 7: 132,874,965 A145T probably damaging Het
Acaca C T 11: 84,292,929 T32I probably benign Het
Adam6a A T 12: 113,545,050 N348Y possibly damaging Het
Ankdd1a C T 9: 65,508,061 A227T possibly damaging Het
Arhgef38 T C 3: 133,234,708 D39G possibly damaging Het
Arid5b T C 10: 68,097,582 D587G possibly damaging Het
Brwd1 A G 16: 96,007,941 V1963A probably benign Het
Ccdc136 T A 6: 29,410,205 L34Q probably damaging Het
Cdh2 T C 18: 16,774,522 Q53R probably benign Het
Celsr2 G A 3: 108,401,214 S1799L probably damaging Het
Cenpe A G 3: 135,230,175 E457G probably benign Het
Cmtm1 A T 8: 104,305,163 M283K possibly damaging Het
Dcdc5 T C 2: 106,368,171 noncoding transcript Het
Decr1 T A 4: 15,924,261 M220L probably benign Het
Dgkg T G 16: 22,519,561 D592A probably damaging Het
Dkkl1 T C 7: 45,211,438 Q39R probably benign Het
Dyrk1a T A 16: 94,659,514 C10S probably damaging Het
Efcab2 A T 1: 178,481,371 E146D probably benign Het
Efhc1 T C 1: 20,979,428 V504A possibly damaging Het
Ermard T G 17: 15,053,205 probably null Het
Espl1 T C 15: 102,315,812 V1266A probably benign Het
Fbxw22 A C 9: 109,403,397 V40G probably damaging Het
Gm3460 A T 14: 6,619,410 I194N possibly damaging Het
Gnai2 C T 9: 107,620,097 V33M possibly damaging Het
H2-DMb1 T C 17: 34,157,532 probably null Het
Hc T C 2: 34,989,839 probably null Het
Iars T C 13: 49,708,445 S491P probably damaging Het
Knl1 T A 2: 119,069,318 L500H probably damaging Het
Lamb1 A T 12: 31,269,147 T102S probably damaging Het
Lrrc7 A G 3: 158,160,736 S1123P probably damaging Het
Mettl5 C A 2: 69,871,727 probably null Het
Mmp11 A G 10: 75,923,984 *4R probably null Het
Myom1 A T 17: 71,082,488 D911V probably benign Het
Nid1 A G 13: 13,463,782 T96A probably benign Het
Nlrp4e G T 7: 23,353,172 V839L probably benign Het
Notch3 A T 17: 32,151,154 probably null Het
Olfr1082 T C 2: 86,594,067 T254A possibly damaging Het
Pcdh8 T C 14: 79,767,651 H978R probably benign Het
Pde8b A T 13: 95,042,000 C537* probably null Het
Polr1b T C 2: 129,125,446 F920L probably damaging Het
Polr2f A G 15: 79,151,373 T87A probably damaging Het
Pon2 T A 6: 5,272,421 H133L probably damaging Het
Ptk2b T A 14: 66,178,831 E205V probably damaging Het
Rb1cc1 T A 1: 6,244,133 M343K probably benign Het
Rlf G A 4: 121,148,610 R1058W probably damaging Het
S100z T A 13: 95,478,574 K28* probably null Het
Scarf1 T A 11: 75,520,315 N273K probably benign Het
Setd2 A G 9: 110,556,366 I136M unknown Het
Sfrp2 A G 3: 83,766,984 D148G probably benign Het
Slc24a4 A G 12: 102,254,510 E400G probably benign Het
Slc2a9 T G 5: 38,453,121 I112L probably benign Het
Smc5 A T 19: 23,208,948 Y972* probably null Het
Sntg1 T C 1: 8,445,024 probably null Het
Stag1 A G 9: 100,757,733 D114G probably damaging Het
Suclg1 T C 6: 73,256,209 S46P probably damaging Het
Synj1 C T 16: 90,946,815 A1186T probably benign Het
Tas2r124 A G 6: 132,755,447 T240A probably benign Het
Tax1bp1 T C 6: 52,744,356 probably null Het
Tmprss15 T C 16: 78,962,170 T887A probably benign Het
Ttn T C 2: 76,706,593 I34963V probably benign Het
Unc79 G A 12: 103,112,619 G1485D probably damaging Het
Usp9y G T Y: 1,385,355 H633N probably benign Homo
Vmn2r99 A T 17: 19,382,605 N541Y probably damaging Het
Zbtb11 T A 16: 55,990,491 N337K probably benign Het
Zfp260 T A 7: 30,104,842 C56S possibly damaging Het
Zfp457 C T 13: 67,292,682 E610K probably damaging Het
Other mutations in Tchh
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00155:Tchh APN 3 93445299 missense unknown
IGL00338:Tchh APN 3 93447644 missense unknown
IGL00541:Tchh APN 3 93446250 missense unknown
IGL02510:Tchh APN 3 93444078 missense unknown
IGL02622:Tchh APN 3 93443412 missense probably damaging 1.00
IGL03164:Tchh APN 3 93445392 missense unknown
IGL03331:Tchh APN 3 93443418 missense probably damaging 1.00
PIT4453001:Tchh UTSW 3 93445880 missense unknown
R0334:Tchh UTSW 3 93445616 missense unknown
R0603:Tchh UTSW 3 93443781 missense possibly damaging 0.91
R1186:Tchh UTSW 3 93448046 missense unknown
R1241:Tchh UTSW 3 93444972 missense unknown
R1610:Tchh UTSW 3 93444839 missense unknown
R1768:Tchh UTSW 3 93443575 missense possibly damaging 0.68
R1843:Tchh UTSW 3 93446780 missense unknown
R1866:Tchh UTSW 3 93447760 missense unknown
R1978:Tchh UTSW 3 93446799 missense unknown
R2008:Tchh UTSW 3 93445974 missense unknown
R2011:Tchh UTSW 3 93446961 missense unknown
R2087:Tchh UTSW 3 93443918 missense unknown
R2177:Tchh UTSW 3 93444132 missense unknown
R2292:Tchh UTSW 3 93442382 missense probably damaging 1.00
R2418:Tchh UTSW 3 93445629 missense unknown
R2877:Tchh UTSW 3 93444228 missense unknown
R2995:Tchh UTSW 3 93447750 small deletion probably benign
R2997:Tchh UTSW 3 93447750 small deletion probably benign
R3439:Tchh UTSW 3 93447393 missense unknown
R3440:Tchh UTSW 3 93445107 missense unknown
R3441:Tchh UTSW 3 93445107 missense unknown
R4063:Tchh UTSW 3 93446991 missense unknown
R4550:Tchh UTSW 3 93445310 missense unknown
R4720:Tchh UTSW 3 93447882 missense unknown
R4836:Tchh UTSW 3 93445148 missense unknown
R4836:Tchh UTSW 3 93447588 missense unknown
R4880:Tchh UTSW 3 93443823 missense possibly damaging 0.85
R4895:Tchh UTSW 3 93445686 missense unknown
R5188:Tchh UTSW 3 93446679 missense unknown
R5404:Tchh UTSW 3 93447675 missense unknown
R5435:Tchh UTSW 3 93443672 missense possibly damaging 0.53
R5578:Tchh UTSW 3 93444311 nonsense probably null
R5678:Tchh UTSW 3 93445626 missense unknown
R5697:Tchh UTSW 3 93445043 nonsense probably null
R5768:Tchh UTSW 3 93446181 missense unknown
R5809:Tchh UTSW 3 93445573 missense unknown
R5934:Tchh UTSW 3 93444112 missense unknown
R5945:Tchh UTSW 3 93445337 missense unknown
R6329:Tchh UTSW 3 93446445 missense unknown
R6397:Tchh UTSW 3 93445866 missense unknown
R6818:Tchh UTSW 3 93443411 missense probably damaging 1.00
R6997:Tchh UTSW 3 93446708 small deletion probably benign
R7174:Tchh UTSW 3 93446171 missense unknown
R7268:Tchh UTSW 3 93446708 small deletion probably benign
R7270:Tchh UTSW 3 93444530 missense unknown
R7449:Tchh UTSW 3 93446708 small deletion probably benign
R7745:Tchh UTSW 3 93444777 missense unknown
R8201:Tchh UTSW 3 93443474 missense probably damaging 0.98
Z1088:Tchh UTSW 3 93445682 nonsense probably null
Z1176:Tchh UTSW 3 93446859 missense unknown
Predicted Primers PCR Primer
(F):5'- GCGTGACAGAAAATTCCGTG -3'
(R):5'- TTTAAGGGCGGTATTGAGACC -3'

Sequencing Primer
(F):5'- CGTGAGGTAGAAGAGCTTCGCC -3'
(R):5'- CTGCTCCTGGATGTACTCATAGAG -3'
Posted On2018-04-02