Mutagenetix > Incidental Mutation

Incidental Mutation 'R6313:Celsr2'

510507

Institutional Source

Beutler Lab

Gene Symbol

Celsr2

Ensembl Gene

ENSMUSG00000068740

Gene Name

cadherin, EGF LAG seven-pass G-type receptor 2

Synonyms

mfmi1, EGFL2, flamingo

MMRRC Submission

044470-MU

Accession Numbers

Genbank: NM_017392.3, NM_001004177.2 ; Ensembl: ENSMUST00000090558

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R6313 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

108390851-108415552 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 108401214 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Leucine at position 1799 (S1799L)

Ref Sequence

ENSEMBL: ENSMUSP00000088046 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000090558]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000090558
AA Change: S1799L

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000088046
Gene: ENSMUSG00000068740
AA Change: S1799L

Domain	Start	End	E-Value	Type
signal peptide	1	31	N/A	INTRINSIC
low complexity region	35	53	N/A	INTRINSIC
CA	203	287	1.36e-26	SMART
CA	311	397	1.33e-29	SMART
CA	421	503	2.59e-27	SMART
CA	527	608	3.33e-30	SMART
CA	632	710	5.18e-18	SMART
CA	734	813	1.08e-29	SMART
CA	837	919	8.08e-29	SMART
low complexity region	920	932	N/A	INTRINSIC
CA	943	1021	4.3e-24	SMART
CA	1049	1125	1.87e-1	SMART
low complexity region	1188	1198	N/A	INTRINSIC
EGF	1231	1286	1.81e-3	SMART
EGF_CA	1288	1324	2.24e-8	SMART
EGF	1331	1366	6.65e-2	SMART
LamG	1387	1554	8.4e-30	SMART
EGF	1577	1610	8e-5	SMART
LamG	1636	1770	1.56e-24	SMART
EGF	1796	1829	2.35e-2	SMART
EGF	1831	1867	3.88e-3	SMART
TNFR	1908	1943	1.35e-1	SMART
EGF_Lam	1924	1969	9.54e-12	SMART
HormR	1972	2034	1.57e-20	SMART
Pfam:GAIN	2046	2289	3e-62	PFAM
GPS	2315	2368	1.86e-25	SMART
Pfam:7tm_2	2373	2605	1.1e-48	PFAM
low complexity region	2715	2733	N/A	INTRINSIC
low complexity region	2857	2873	N/A	INTRINSIC
low complexity region	2874	2881	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000126349

Predicted Effect

probably benign
Transcript: ENSMUST00000147251

SMART Domains

Protein: ENSMUSP00000122329
Gene: ENSMUSG00000068740

Domain	Start	End	E-Value	Type
Pfam:GAIN	35	278	5.1e-63	PFAM
GPS	304	357	1.86e-25	SMART
Pfam:7tm_2	362	594	2e-49	PFAM
low complexity region	704	722	N/A	INTRINSIC
low complexity region	846	862	N/A	INTRINSIC
low complexity region	863	870	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000147565

SMART Domains

Protein: ENSMUSP00000122516
Gene: ENSMUSG00000068740

Domain	Start	End	E-Value	Type
EGF	13	46	8e-5	SMART
LamG	72	206	1.56e-24	SMART

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.5%
20x: 98.4%

Validation Efficiency

100% (70/70)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the flamingo subfamily, part of the cadherin superfamily. The flamingo subfamily consists of nonclassic-type cadherins; a subpopulation that does not interact with catenins. The flamingo cadherins are located at the plasma membrane and have nine cadherin domains, seven epidermal growth factor-like repeats and two laminin A G-type repeats in their ectodomain. They also have seven transmembrane domains, a characteristic unique to this subfamily. It is postulated that these proteins are receptors involved in contact-mediated communication, with cadherin domains acting as homophilic binding regions and the EGF-like domains involved in cell adhesion and receptor-ligand interactions. The specific function of this particular member has not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this allele have mild to moderately dilated lateral ventricles in the brain but are otherwise normal. [provided by MGI curators]

Allele List at MGI

All alleles(4) : Targeted, knock-out(1) Targeted, other(3)

Other mutations in this stock

Total: 69 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1810046K07Rik	C	T	9: 51,290,181	D192N	probably damaging	Het
4932415D10Rik	T	C	10: 82,293,636	N1180S	probably benign	Het
Abca16	T	C	7: 120,527,121	F1167L	probably damaging	Het
Abraxas2	G	A	7: 132,874,965	A145T	probably damaging	Het
Acaca	C	T	11: 84,292,929	T32I	probably benign	Het
Adam6a	A	T	12: 113,545,050	N348Y	possibly damaging	Het
Ankdd1a	C	T	9: 65,508,061	A227T	possibly damaging	Het
Arhgef38	T	C	3: 133,234,708	D39G	possibly damaging	Het
Arid5b	T	C	10: 68,097,582	D587G	possibly damaging	Het
Brwd1	A	G	16: 96,007,941	V1963A	probably benign	Het
Ccdc136	T	A	6: 29,410,205	L34Q	probably damaging	Het
Cdh2	T	C	18: 16,774,522	Q53R	probably benign	Het
Cenpe	A	G	3: 135,230,175	E457G	probably benign	Het
Cmtm1	A	T	8: 104,305,163	M283K	possibly damaging	Het
Dcdc5	T	C	2: 106,368,171		noncoding transcript	Het
Decr1	T	A	4: 15,924,261	M220L	probably benign	Het
Dgkg	T	G	16: 22,519,561	D592A	probably damaging	Het
Dkkl1	T	C	7: 45,211,438	Q39R	probably benign	Het
Dyrk1a	T	A	16: 94,659,514	C10S	possibly damaging	Het
Efcab2	A	T	1: 178,481,371	E146D	probably benign	Het
Efhc1	T	C	1: 20,979,428	V504A	possibly damaging	Het
Ermard	T	G	17: 15,053,205		probably null	Het
Espl1	T	C	15: 102,315,812	V1266A	probably benign	Het
Fbxw22	A	C	9: 109,403,397	V40G	probably damaging	Het
Gm3460	A	T	14: 6,619,410	I194N	possibly damaging	Het
Gnai2	C	T	9: 107,620,097	V33M	possibly damaging	Het
H2-DMb1	T	C	17: 34,157,532		probably null	Het
Hc	T	C	2: 34,989,839		probably null	Het
Iars	T	C	13: 49,708,445	S491P	probably damaging	Het
Knl1	T	A	2: 119,069,318	L500H	probably damaging	Het
Lamb1	A	T	12: 31,269,147	T102S	probably damaging	Het
Lrrc7	A	G	3: 158,160,736	S1123P	probably damaging	Het
Mettl5	C	A	2: 69,871,727		probably null	Het
Mmp11	A	G	10: 75,923,984	*4R	probably null	Het
Myom1	A	T	17: 71,082,488	D911V	probably benign	Het
Nid1	A	G	13: 13,463,782	T96A	probably benign	Het
Nlrp4e	G	T	7: 23,353,172	V839L	probably benign	Het
Notch3	A	T	17: 32,151,154		probably null	Het
Olfr1082	T	C	2: 86,594,067	T254A	possibly damaging	Het
Pcdh8	T	C	14: 79,767,651	H978R	probably benign	Het
Pde8b	A	T	13: 95,042,000	C537*	probably null	Het
Polr1b	T	C	2: 129,125,446	F920L	probably damaging	Het
Polr2f	A	G	15: 79,151,373	T87A	probably damaging	Het
Pon2	T	A	6: 5,272,421	H133L	probably damaging	Het
Ptk2b	T	A	14: 66,178,831	E205V	probably damaging	Het
Rb1cc1	T	A	1: 6,244,133	M343K	probably benign	Het
Rlf	G	A	4: 121,148,610	R1058W	probably damaging	Het
S100z	T	A	13: 95,478,574	K28*	probably null	Het
Scarf1	T	A	11: 75,520,315	N273K	probably benign	Het
Setd2	A	G	9: 110,556,366	I136M	unknown	Het
Sfrp2	A	G	3: 83,766,984	D148G	probably benign	Het
Slc24a4	A	G	12: 102,254,510	E400G	probably benign	Het
Slc2a9	T	G	5: 38,453,121	I112L	probably benign	Het
Smc5	A	T	19: 23,208,948	Y972*	probably null	Het
Sntg1	T	C	1: 8,445,024		probably null	Het
Stag1	A	G	9: 100,757,733	D114G	probably damaging	Het
Suclg1	T	C	6: 73,256,209	S46P	probably damaging	Het
Synj1	C	T	16: 90,946,815	A1186T	probably benign	Het
Tas2r124	A	G	6: 132,755,447	T240A	probably benign	Het
Tax1bp1	T	C	6: 52,744,356		probably null	Het
Tchh	C	A	3: 93,447,851	Q1533K	unknown	Het
Tmprss15	T	C	16: 78,962,170	T887A	probably benign	Het
Ttn	T	C	2: 76,706,593	I34963V	probably benign	Het
Unc79	G	A	12: 103,112,619	G1485D	probably damaging	Het
Usp9y	G	T	Y: 1,385,355	H633N	probably benign	Homo
Vmn2r99	A	T	17: 19,382,605	N541Y	probably damaging	Het
Zbtb11	T	A	16: 55,990,491	N337K	probably benign	Het
Zfp260	T	A	7: 30,104,842	C56S	possibly damaging	Het
Zfp457	C	T	13: 67,292,682	E610K	probably damaging	Het

Other mutations in Celsr2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00898:Celsr2	APN	3	108413879	missense	possibly damaging	0.49
IGL01020:Celsr2	APN	3	108403270	missense	probably damaging	0.99
IGL01420:Celsr2	APN	3	108393763	missense	probably benign	0.13
IGL01448:Celsr2	APN	3	108393239	missense	probably damaging	0.99
IGL01559:Celsr2	APN	3	108406867	missense	possibly damaging	0.75
IGL01674:Celsr2	APN	3	108414843	missense	probably damaging	1.00
IGL01863:Celsr2	APN	3	108394022	missense	probably benign	0.00
IGL02309:Celsr2	APN	3	108396011	missense	probably damaging	1.00
IGL02325:Celsr2	APN	3	108412871	missense	probably damaging	1.00
IGL02409:Celsr2	APN	3	108413955	missense	probably damaging	1.00
IGL02514:Celsr2	APN	3	108397510	missense	probably benign	0.01
IGL02812:Celsr2	APN	3	108414113	missense	probably benign	0.25
IGL02894:Celsr2	APN	3	108395210	missense	probably damaging	1.00
IGL03281:Celsr2	APN	3	108412940	missense	probably damaging	1.00
barrow	UTSW	3	108394965	missense	possibly damaging	0.92
goldeneye	UTSW	3	108394919	missense	probably damaging	1.00
1mM(1):Celsr2	UTSW	3	108400838	missense	probably benign	0.01
ANU74:Celsr2	UTSW	3	108412499	missense	probably damaging	1.00
IGL02799:Celsr2	UTSW	3	108414062	missense	probably damaging	1.00
R0011:Celsr2	UTSW	3	108413402	missense	probably benign	0.19
R0031:Celsr2	UTSW	3	108413063	missense	probably damaging	1.00
R0049:Celsr2	UTSW	3	108397254	missense	probably benign	0.12
R0049:Celsr2	UTSW	3	108397254	missense	probably benign	0.12
R0090:Celsr2	UTSW	3	108393327	splice site	probably benign
R0140:Celsr2	UTSW	3	108397933	missense	probably benign	0.00
R0524:Celsr2	UTSW	3	108401587	missense	probably damaging	1.00
R0607:Celsr2	UTSW	3	108403895	critical splice donor site	probably null
R0662:Celsr2	UTSW	3	108398520	missense	probably damaging	0.99
R0690:Celsr2	UTSW	3	108414977	missense	probably damaging	1.00
R0691:Celsr2	UTSW	3	108412623	missense	probably damaging	1.00
R0710:Celsr2	UTSW	3	108412712	missense	probably benign	0.42
R0730:Celsr2	UTSW	3	108398606	missense	probably damaging	1.00
R0815:Celsr2	UTSW	3	108401301	missense	possibly damaging	0.56
R0848:Celsr2	UTSW	3	108414338	missense	probably benign
R0989:Celsr2	UTSW	3	108403272	missense	probably benign	0.00
R1185:Celsr2	UTSW	3	108399709	missense	possibly damaging	0.95
R1185:Celsr2	UTSW	3	108399709	missense	possibly damaging	0.95
R1185:Celsr2	UTSW	3	108399709	missense	possibly damaging	0.95
R1469:Celsr2	UTSW	3	108414108	missense	probably damaging	1.00
R1469:Celsr2	UTSW	3	108414108	missense	probably damaging	1.00
R1474:Celsr2	UTSW	3	108393739	missense	possibly damaging	0.91
R1608:Celsr2	UTSW	3	108402483	missense	probably damaging	1.00
R1653:Celsr2	UTSW	3	108413520	missense	possibly damaging	0.52
R1659:Celsr2	UTSW	3	108414095	missense	probably benign
R1689:Celsr2	UTSW	3	108407304	missense	possibly damaging	0.63
R1848:Celsr2	UTSW	3	108401310	missense	probably benign	0.35
R1859:Celsr2	UTSW	3	108396630	missense	probably damaging	1.00
R1918:Celsr2	UTSW	3	108398650	missense	probably benign	0.05
R1974:Celsr2	UTSW	3	108414214	missense	probably damaging	1.00
R2042:Celsr2	UTSW	3	108402495	missense	probably damaging	0.98
R2167:Celsr2	UTSW	3	108413193	missense	probably damaging	0.96
R2333:Celsr2	UTSW	3	108398605	missense	probably benign	0.16
R2434:Celsr2	UTSW	3	108404479	missense	probably damaging	1.00
R2504:Celsr2	UTSW	3	108413591	missense	probably benign	0.11
R3420:Celsr2	UTSW	3	108414416	missense	probably benign	0.03
R3712:Celsr2	UTSW	3	108400839	missense	probably benign
R3723:Celsr2	UTSW	3	108397415	splice site	probably benign
R3809:Celsr2	UTSW	3	108403239	missense	possibly damaging	0.67
R4018:Celsr2	UTSW	3	108394965	missense	possibly damaging	0.92
R4126:Celsr2	UTSW	3	108402097	missense	possibly damaging	0.71
R4177:Celsr2	UTSW	3	108413978	missense	probably damaging	0.96
R4232:Celsr2	UTSW	3	108413772	missense	probably benign	0.02
R4293:Celsr2	UTSW	3	108393677	missense	probably benign	0.01
R4458:Celsr2	UTSW	3	108394997	missense	probably damaging	0.98
R4621:Celsr2	UTSW	3	108395216	missense	possibly damaging	0.86
R4645:Celsr2	UTSW	3	108395969	missense	probably damaging	1.00
R4700:Celsr2	UTSW	3	108397231	missense	probably benign	0.24
R4732:Celsr2	UTSW	3	108398952	missense	probably damaging	0.99
R4733:Celsr2	UTSW	3	108398952	missense	probably damaging	0.99
R4901:Celsr2	UTSW	3	108406987	missense	possibly damaging	0.81
R4932:Celsr2	UTSW	3	108402758	missense	probably damaging	1.00
R4989:Celsr2	UTSW	3	108412629	missense	possibly damaging	0.62
R5052:Celsr2	UTSW	3	108412358	missense	probably damaging	1.00
R5093:Celsr2	UTSW	3	108413373	missense	possibly damaging	0.66
R5114:Celsr2	UTSW	3	108393996	missense	probably benign	0.05
R5120:Celsr2	UTSW	3	108393120	missense	probably benign	0.02
R5135:Celsr2	UTSW	3	108398659	missense	probably damaging	1.00
R5247:Celsr2	UTSW	3	108397630	missense	probably benign	0.34
R5381:Celsr2	UTSW	3	108402757	missense	probably damaging	1.00
R5412:Celsr2	UTSW	3	108399995	missense	probably damaging	1.00
R5445:Celsr2	UTSW	3	108392658	missense	probably benign	0.01
R5528:Celsr2	UTSW	3	108413294	missense	probably damaging	1.00
R5598:Celsr2	UTSW	3	108402803	missense	possibly damaging	0.82
R5652:Celsr2	UTSW	3	108396735	missense	probably null	0.49
R5697:Celsr2	UTSW	3	108403921	nonsense	probably null
R5718:Celsr2	UTSW	3	108393358	missense	probably benign
R5869:Celsr2	UTSW	3	108413909	missense	probably damaging	1.00
R5876:Celsr2	UTSW	3	108413943	missense	probably damaging	0.96
R6021:Celsr2	UTSW	3	108401245	missense	probably benign
R6054:Celsr2	UTSW	3	108406963	missense	possibly damaging	0.95
R6244:Celsr2	UTSW	3	108393128	missense	probably damaging	0.96
R6322:Celsr2	UTSW	3	108412574	missense	probably damaging	1.00
R6555:Celsr2	UTSW	3	108394919	missense	probably damaging	1.00
R6682:Celsr2	UTSW	3	108400501	critical splice donor site	probably null
R7062:Celsr2	UTSW	3	108402510	missense	possibly damaging	0.95
R7110:Celsr2	UTSW	3	108397865	missense	probably damaging	1.00
R7139:Celsr2	UTSW	3	108415359	missense	unknown
R7326:Celsr2	UTSW	3	108394995	missense	possibly damaging	0.85
R7425:Celsr2	UTSW	3	108402457	missense	probably damaging	1.00
R7452:Celsr2	UTSW	3	108413090	missense	possibly damaging	0.95
R7461:Celsr2	UTSW	3	108395640	missense	probably damaging	1.00
R7502:Celsr2	UTSW	3	108398902	missense	probably benign	0.00
R7613:Celsr2	UTSW	3	108395640	missense	probably damaging	1.00
R7644:Celsr2	UTSW	3	108413490	missense	probably damaging	0.99
R7666:Celsr2	UTSW	3	108398588	missense	probably benign
R7687:Celsr2	UTSW	3	108397769	missense	probably benign	0.27
R7695:Celsr2	UTSW	3	108402753	missense	probably damaging	1.00
R8002:Celsr2	UTSW	3	108403969	missense	probably damaging	1.00
R8052:Celsr2	UTSW	3	108412655	missense	probably damaging	1.00
R8283:Celsr2	UTSW	3	108396455	missense	probably damaging	1.00
R8356:Celsr2	UTSW	3	108413531	missense	possibly damaging	0.90
R8381:Celsr2	UTSW	3	108395636	missense	probably damaging	1.00
R8427:Celsr2	UTSW	3	108392633	makesense	probably null
R8435:Celsr2	UTSW	3	108414399	missense	probably benign
R8438:Celsr2	UTSW	3	108393823	missense	probably damaging	1.00
R8458:Celsr2	UTSW	3	108398902	missense	probably benign	0.00
R8460:Celsr2	UTSW	3	108396777	missense	possibly damaging	0.84
R8462:Celsr2	UTSW	3	108412851	nonsense	probably null
R8479:Celsr2	UTSW	3	108398902	missense	probably benign	0.00
R8480:Celsr2	UTSW	3	108398902	missense	probably benign	0.00
R8512:Celsr2	UTSW	3	108413838	missense	probably damaging	1.00
R8694:Celsr2	UTSW	3	108406860	missense	probably damaging	1.00
R8772:Celsr2	UTSW	3	108397073	missense	possibly damaging	0.84
R8843:Celsr2	UTSW	3	108396127	splice site	probably benign
R8888:Celsr2	UTSW	3	108413564	missense	possibly damaging	0.95
R8895:Celsr2	UTSW	3	108413564	missense	possibly damaging	0.95
R8917:Celsr2	UTSW	3	108396566	missense	probably benign	0.00
R9119:Celsr2	UTSW	3	108401972	missense	possibly damaging	0.90
R9169:Celsr2	UTSW	3	108402546	missense	probably benign	0.04
R9209:Celsr2	UTSW	3	108414033	missense	probably benign	0.02
R9342:Celsr2	UTSW	3	108413126	missense	probably damaging	1.00
R9416:Celsr2	UTSW	3	108414768	missense	probably damaging	0.96
R9493:Celsr2	UTSW	3	108393758	missense	probably damaging	1.00
R9564:Celsr2	UTSW	3	108414518	missense	probably damaging	1.00
R9598:Celsr2	UTSW	3	108415262	missense	possibly damaging	0.72
R9629:Celsr2	UTSW	3	108401599	missense	probably damaging	1.00
R9691:Celsr2	UTSW	3	108394235	missense	probably damaging	1.00
X0020:Celsr2	UTSW	3	108396110	missense	probably damaging	1.00
X0050:Celsr2	UTSW	3	108401272	missense	probably benign	0.09
Z1088:Celsr2	UTSW	3	108414117	missense	probably damaging	1.00
Z1176:Celsr2	UTSW	3	108393131	missense	probably benign	0.10
Z1176:Celsr2	UTSW	3	108412341	missense	probably benign	0.07
Z1177:Celsr2	UTSW	3	108412220	missense	probably damaging	1.00
Z1177:Celsr2	UTSW	3	108413571	missense	probably benign	0.32
Z1191:Celsr2	UTSW	3	108414549	missense	possibly damaging	0.68

Predicted Primers

PCR Primer
(F):5'- CTCTAAGCATTGCACCAGGC -3'
(R):5'- TTTGCAGGTGAGTCTCCTCC -3'

Sequencing Primer
(F):5'- CCATAACCCTGTAGGAGATGACG -3'
(R):5'- GGTGAGTCTCCTCCCCTGAC -3'

Posted On

2018-04-02