Mutagenetix > Incidental Mutation

Incidental Mutation 'R6313:Cenpe'

510509

Institutional Source

Beutler Lab

Gene Symbol

Cenpe

Ensembl Gene

ENSMUSG00000045328

Gene Name

centromere protein E

Synonyms

312kDa, CENP-E, Kif10, N-7 kinesin

MMRRC Submission

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R6313 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

135212537-135273611 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 135230175 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Glycine at position 457 (E457G)

Ref Sequence

ENSEMBL: ENSMUSP00000057938 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000062893]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000062893
AA Change: E457G

PolyPhen 2 Score 0.258 (Sensitivity: 0.91; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000057938
Gene: ENSMUSG00000045328
AA Change: E457G

Domain	Start	End	E-Value	Type
KISc	4	337	2.4e-172	SMART
coiled coil region	493	612	N/A	INTRINSIC
coiled coil region	637	752	N/A	INTRINSIC
internal_repeat_1	768	801	3.5e-5	PROSPERO
coiled coil region	821	991	N/A	INTRINSIC
low complexity region	1119	1143	N/A	INTRINSIC
internal_repeat_2	1225	1238	6.26e-5	PROSPERO
low complexity region	1446	1467	N/A	INTRINSIC
low complexity region	1480	1498	N/A	INTRINSIC
internal_repeat_2	1614	1627	6.26e-5	PROSPERO
internal_repeat_1	2018	2051	3.5e-5	PROSPERO
coiled coil region	2226	2247	N/A	INTRINSIC
coiled coil region	2316	2363	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.5%
20x: 98.4%

Validation Efficiency

100% (70/70)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Centrosome-associated protein E (CENPE) is a kinesin-like motor protein that accumulates in the G2 phase of the cell cycle. Unlike other centrosome-associated proteins, it is not present during interphase and first appears at the centromere region of chromosomes during prometaphase. This protein is required for stable spindle microtubule capture at kinetochores which is a necessary step in chromosome alignment during prometaphase. This protein also couples chromosome position to microtubule depolymerizing activity. Alternative splicing results in multiple transcript variants encoding distinct protein isoforms. [provided by RefSeq, Nov 2014]
PHENOTYPE: Mice homozygous for a knock-out allele display early embryonic lethality. Mutant embryos grown in culture exhibit inner cell mass growth defects and mitotic chromosome misalignment. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 69 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1810046K07Rik	C	T	9: 51,290,181	D192N	probably damaging	Het
4932415D10Rik	T	C	10: 82,293,636	N1180S	probably benign	Het
Abca16	T	C	7: 120,527,121	F1167L	probably damaging	Het
Abraxas2	G	A	7: 132,874,965	A145T	probably damaging	Het
Acaca	C	T	11: 84,292,929	T32I	probably benign	Het
Adam6a	A	T	12: 113,545,050	N348Y	possibly damaging	Het
Ankdd1a	C	T	9: 65,508,061	A227T	possibly damaging	Het
Arhgef38	T	C	3: 133,234,708	D39G	possibly damaging	Het
Arid5b	T	C	10: 68,097,582	D587G	possibly damaging	Het
Brwd1	A	G	16: 96,007,941	V1963A	probably benign	Het
Ccdc136	T	A	6: 29,410,205	L34Q	probably damaging	Het
Cdh2	T	C	18: 16,774,522	Q53R	probably benign	Het
Celsr2	G	A	3: 108,401,214	S1799L	probably damaging	Het
Cmtm1	A	T	8: 104,305,163	M283K	possibly damaging	Het
Dcdc5	T	C	2: 106,368,171		noncoding transcript	Het
Decr1	T	A	4: 15,924,261	M220L	probably benign	Het
Dgkg	T	G	16: 22,519,561	D592A	probably damaging	Het
Dkkl1	T	C	7: 45,211,438	Q39R	probably benign	Het
Dyrk1a	T	A	16: 94,659,514	C10S	possibly damaging	Het
Efcab2	A	T	1: 178,481,371	E146D	probably benign	Het
Efhc1	T	C	1: 20,979,428	V504A	possibly damaging	Het
Ermard	T	G	17: 15,053,205		probably null	Het
Espl1	T	C	15: 102,315,812	V1266A	probably benign	Het
Fbxw22	A	C	9: 109,403,397	V40G	probably damaging	Het
Gm3460	A	T	14: 6,619,410	I194N	possibly damaging	Het
Gnai2	C	T	9: 107,620,097	V33M	possibly damaging	Het
H2-DMb1	T	C	17: 34,157,532		probably null	Het
Hc	T	C	2: 34,989,839		probably null	Het
Iars	T	C	13: 49,708,445	S491P	probably damaging	Het
Knl1	T	A	2: 119,069,318	L500H	probably damaging	Het
Lamb1	A	T	12: 31,269,147	T102S	probably damaging	Het
Lrrc7	A	G	3: 158,160,736	S1123P	probably damaging	Het
Mettl5	C	A	2: 69,871,727		probably null	Het
Mmp11	A	G	10: 75,923,984	*4R	probably null	Het
Myom1	A	T	17: 71,082,488	D911V	probably benign	Het
Nid1	A	G	13: 13,463,782	T96A	probably benign	Het
Nlrp4e	G	T	7: 23,353,172	V839L	probably benign	Het
Notch3	A	T	17: 32,151,154		probably null	Het
Olfr1082	T	C	2: 86,594,067	T254A	possibly damaging	Het
Pcdh8	T	C	14: 79,767,651	H978R	probably benign	Het
Pde8b	A	T	13: 95,042,000	C537*	probably null	Het
Polr1b	T	C	2: 129,125,446	F920L	probably damaging	Het
Polr2f	A	G	15: 79,151,373	T87A	probably damaging	Het
Pon2	T	A	6: 5,272,421	H133L	probably damaging	Het
Ptk2b	T	A	14: 66,178,831	E205V	probably damaging	Het
Rb1cc1	T	A	1: 6,244,133	M343K	probably benign	Het
Rlf	G	A	4: 121,148,610	R1058W	probably damaging	Het
S100z	T	A	13: 95,478,574	K28*	probably null	Het
Scarf1	T	A	11: 75,520,315	N273K	probably benign	Het
Setd2	A	G	9: 110,556,366	I136M	unknown	Het
Sfrp2	A	G	3: 83,766,984	D148G	probably benign	Het
Slc24a4	A	G	12: 102,254,510	E400G	probably benign	Het
Slc2a9	T	G	5: 38,453,121	I112L	probably benign	Het
Smc5	A	T	19: 23,208,948	Y972*	probably null	Het
Sntg1	T	C	1: 8,445,024		probably null	Het
Stag1	A	G	9: 100,757,733	D114G	probably damaging	Het
Suclg1	T	C	6: 73,256,209	S46P	probably damaging	Het
Synj1	C	T	16: 90,946,815	A1186T	probably benign	Het
Tas2r124	A	G	6: 132,755,447	T240A	probably benign	Het
Tax1bp1	T	C	6: 52,744,356		probably null	Het
Tchh	C	A	3: 93,447,851	Q1533K	unknown	Het
Tmprss15	T	C	16: 78,962,170	T887A	probably benign	Het
Ttn	T	C	2: 76,706,593	I34963V	probably benign	Het
Unc79	G	A	12: 103,112,619	G1485D	probably damaging	Het
Usp9y	G	T	Y: 1,385,355	H633N	probably benign	Homo
Vmn2r99	A	T	17: 19,382,605	N541Y	probably damaging	Het
Zbtb11	T	A	16: 55,990,491	N337K	probably benign	Het
Zfp260	T	A	7: 30,104,842	C56S	possibly damaging	Het
Zfp457	C	T	13: 67,292,682	E610K	probably damaging	Het

Other mutations in Cenpe

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00655:Cenpe	APN	3	135231455	critical splice donor site	probably null
IGL00799:Cenpe	APN	3	135228917	critical splice donor site	probably null
IGL00815:Cenpe	APN	3	135259351	missense	probably benign
IGL01446:Cenpe	APN	3	135237539	missense	probably benign	0.01
IGL01469:Cenpe	APN	3	135228806	missense	probably damaging	1.00
IGL01843:Cenpe	APN	3	135218507	missense	possibly damaging	0.88
IGL02254:Cenpe	APN	3	135255477	missense	probably benign
IGL02337:Cenpe	APN	3	135220276	splice site	probably benign
IGL02382:Cenpe	APN	3	135247386	missense	probably benign
IGL02458:Cenpe	APN	3	135230108	nonsense	probably null
IGL02934:Cenpe	APN	3	135264351	missense	probably damaging	1.00
IGL03335:Cenpe	APN	3	135243625	missense	probably benign
R0086:Cenpe	UTSW	3	135264424	splice site	probably benign
R0173:Cenpe	UTSW	3	135259983	missense	probably benign	0.00
R0394:Cenpe	UTSW	3	135216425	splice site	probably benign
R0411:Cenpe	UTSW	3	135222255	missense	probably damaging	1.00
R0624:Cenpe	UTSW	3	135246586	missense	probably benign	0.00
R0634:Cenpe	UTSW	3	135246827	missense	probably damaging	1.00
R0648:Cenpe	UTSW	3	135230082	missense	probably damaging	1.00
R0691:Cenpe	UTSW	3	135217305	missense	probably damaging	1.00
R1184:Cenpe	UTSW	3	135264422	critical splice donor site	probably null
R1530:Cenpe	UTSW	3	135246902	missense	possibly damaging	0.92
R1559:Cenpe	UTSW	3	135270900	missense	probably benign	0.07
R1562:Cenpe	UTSW	3	135238394	missense	possibly damaging	0.53
R1568:Cenpe	UTSW	3	135239758	missense	probably benign	0.01
R1712:Cenpe	UTSW	3	135265933	missense	probably damaging	0.99
R1828:Cenpe	UTSW	3	135246496	missense	probably damaging	0.99
R1846:Cenpe	UTSW	3	135239845	missense	probably damaging	1.00
R1861:Cenpe	UTSW	3	135268979	missense	probably damaging	1.00
R1938:Cenpe	UTSW	3	135247479	missense	probably damaging	0.98
R1961:Cenpe	UTSW	3	135242493	missense	probably damaging	1.00
R2062:Cenpe	UTSW	3	135222321	splice site	probably benign
R2118:Cenpe	UTSW	3	135246884	missense	possibly damaging	0.94
R2127:Cenpe	UTSW	3	135239780	missense	probably benign	0.08
R2156:Cenpe	UTSW	3	135247474	missense	probably benign	0.34
R2265:Cenpe	UTSW	3	135261636	missense	probably benign	0.02
R2268:Cenpe	UTSW	3	135261636	missense	probably benign	0.02
R2392:Cenpe	UTSW	3	135248113	missense	probably damaging	1.00
R2508:Cenpe	UTSW	3	135241073	missense	possibly damaging	0.92
R3084:Cenpe	UTSW	3	135241021	missense	probably damaging	1.00
R3779:Cenpe	UTSW	3	135256576	missense	possibly damaging	0.87
R3833:Cenpe	UTSW	3	135222322	splice site	probably benign
R3974:Cenpe	UTSW	3	135235225	splice site	probably null
R3975:Cenpe	UTSW	3	135235225	splice site	probably null
R3975:Cenpe	UTSW	3	135238472	critical splice donor site	probably null
R4151:Cenpe	UTSW	3	135215153	missense	probably benign	0.36
R4166:Cenpe	UTSW	3	135243718	missense	probably damaging	1.00
R4581:Cenpe	UTSW	3	135247000	missense	probably benign	0.30
R4622:Cenpe	UTSW	3	135243708	missense	probably benign	0.22
R4692:Cenpe	UTSW	3	135216379	missense	probably benign	0.29
R4769:Cenpe	UTSW	3	135248151	missense	probably benign
R4976:Cenpe	UTSW	3	135234876	missense	probably damaging	1.00
R4983:Cenpe	UTSW	3	135234928	missense	probably damaging	1.00
R4990:Cenpe	UTSW	3	135256640	missense	probably damaging	1.00
R5002:Cenpe	UTSW	3	135247081	missense	probably benign
R5057:Cenpe	UTSW	3	135220313	missense	probably benign	0.14
R5063:Cenpe	UTSW	3	135270954	missense	probably damaging	0.99
R5181:Cenpe	UTSW	3	135242303	missense	probably damaging	0.99
R5281:Cenpe	UTSW	3	135230150	missense	possibly damaging	0.89
R5389:Cenpe	UTSW	3	135259388	critical splice donor site	probably null
R5517:Cenpe	UTSW	3	135223265	missense	probably damaging	1.00
R5521:Cenpe	UTSW	3	135269065	missense	probably damaging	1.00
R5607:Cenpe	UTSW	3	135235076	nonsense	probably null
R5608:Cenpe	UTSW	3	135235076	nonsense	probably null
R5627:Cenpe	UTSW	3	135235473	missense	possibly damaging	0.51
R5766:Cenpe	UTSW	3	135248413	missense	probably damaging	0.96
R5783:Cenpe	UTSW	3	135261580	missense	probably benign	0.00
R5933:Cenpe	UTSW	3	135261628	missense	probably benign	0.03
R6073:Cenpe	UTSW	3	135260073	nonsense	probably null
R6163:Cenpe	UTSW	3	135269003	missense	probably damaging	0.99
R6192:Cenpe	UTSW	3	135248530	missense	possibly damaging	0.93
R6224:Cenpe	UTSW	3	135243775	missense	possibly damaging	0.87
R6326:Cenpe	UTSW	3	135239778	missense	probably benign	0.15
R6383:Cenpe	UTSW	3	135251528	missense	probably damaging	1.00
R6418:Cenpe	UTSW	3	135251544	missense	probably damaging	0.99
R6797:Cenpe	UTSW	3	135238138	missense	possibly damaging	0.92
R6810:Cenpe	UTSW	3	135243822	missense	probably benign	0.00
R6989:Cenpe	UTSW	3	135235127	missense	probably damaging	1.00
R7009:Cenpe	UTSW	3	135235201	missense	probably damaging	0.97
R7009:Cenpe	UTSW	3	135235202	missense	probably benign	0.02
R7039:Cenpe	UTSW	3	135255456	missense	probably benign	0.28
R7387:Cenpe	UTSW	3	135247037	missense	probably benign	0.05
R7470:Cenpe	UTSW	3	135242155	missense	probably damaging	1.00
R7535:Cenpe	UTSW	3	135243762	missense	possibly damaging	0.90
R7562:Cenpe	UTSW	3	135248634	missense	probably damaging	1.00
R7573:Cenpe	UTSW	3	135247459	missense	probably damaging	1.00
R7613:Cenpe	UTSW	3	135242302	missense	possibly damaging	0.90
R7741:Cenpe	UTSW	3	135247335	splice site	probably null
R7771:Cenpe	UTSW	3	135240941	splice site	probably null
R7843:Cenpe	UTSW	3	135232959	nonsense	probably null
R7973:Cenpe	UTSW	3	135223250	missense	probably damaging	1.00
R8036:Cenpe	UTSW	3	135239848	frame shift	probably null
R8069:Cenpe	UTSW	3	135243718	missense	probably damaging	1.00
R8151:Cenpe	UTSW	3	135247022	missense	probably benign	0.28
R8176:Cenpe	UTSW	3	135230090	missense	probably damaging	1.00
R8191:Cenpe	UTSW	3	135251614	missense	probably benign
R8251:Cenpe	UTSW	3	135251684	critical splice donor site	probably null
R8425:Cenpe	UTSW	3	135242627	nonsense	probably null
R8488:Cenpe	UTSW	3	135259241	missense	probably damaging	1.00
R8811:Cenpe	UTSW	3	135223240	missense	probably damaging	1.00
R8850:Cenpe	UTSW	3	135225016	missense	probably damaging	1.00
R8879:Cenpe	UTSW	3	135260101	missense	probably damaging	0.99
R8899:Cenpe	UTSW	3	135239883	missense	probably benign	0.18
R9035:Cenpe	UTSW	3	135270811	missense	probably benign	0.01
R9038:Cenpe	UTSW	3	135218036	missense	probably benign	0.00
R9093:Cenpe	UTSW	3	135239880	nonsense	probably null
R9221:Cenpe	UTSW	3	135230078	missense	possibly damaging	0.90
R9365:Cenpe	UTSW	3	135248446	missense	possibly damaging	0.56
R9443:Cenpe	UTSW	3	135270848	missense	probably damaging	0.99
Z1177:Cenpe	UTSW	3	135216385	missense	possibly damaging	0.83

Predicted Primers

PCR Primer
(F):5'- CTCTTGGAATCCTCAAATAAACCTGAC -3'
(R):5'- ACAACGCATCATTCTTAAGGGAC -3'

Sequencing Primer
(F):5'- ACCTGACTTTTATTTCTATCATGGTG -3'
(R):5'- GGACTTGGAATTAACAGAAGCTTATG -3'

Posted On

2018-04-02