Incidental Mutation 'R6313:Slc2a9'
ID510513
Institutional Source Beutler Lab
Gene Symbol Slc2a9
Ensembl Gene ENSMUSG00000005107
Gene Namesolute carrier family 2 (facilitated glucose transporter), member 9
SynonymsSLC2a9A, Glut9, SLC2A9B
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.051) question?
Stock #R6313 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location38349273-38503143 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 38453121 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Leucine at position 112 (I112L)
Ref Sequence ENSEMBL: ENSMUSP00000117390 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005238] [ENSMUST00000067872] [ENSMUST00000067886] [ENSMUST00000122970] [ENSMUST00000129099] [ENSMUST00000143758] [ENSMUST00000147664] [ENSMUST00000155634] [ENSMUST00000156272]
Predicted Effect unknown
Transcript: ENSMUST00000005238
AA Change: I97L
SMART Domains Protein: ENSMUSP00000005238
Gene: ENSMUSG00000005107
AA Change: I97L

DomainStartEndE-ValueType
Pfam:MFS_1 20 208 3.5e-10 PFAM
Pfam:Sugar_tr 25 188 1.1e-35 PFAM
Pfam:Sugar_tr 191 373 5.3e-39 PFAM
Pfam:MFS_1 196 397 1.2e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000067872
AA Change: I97L

PolyPhen 2 Score 0.016 (Sensitivity: 0.95; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000066872
Gene: ENSMUSG00000005107
AA Change: I97L

DomainStartEndE-ValueType
Pfam:MFS_1 22 329 2.2e-16 PFAM
Pfam:Sugar_tr 25 480 2.5e-103 PFAM
Pfam:MFS_1 321 502 3.3e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000067886
AA Change: I112L

PolyPhen 2 Score 0.030 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000063352
Gene: ENSMUSG00000005107
AA Change: I112L

DomainStartEndE-ValueType
Pfam:MFS_1 37 344 1.7e-16 PFAM
Pfam:Sugar_tr 40 495 9.8e-107 PFAM
Pfam:MFS_1 328 518 1.3e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000122970
AA Change: I112L

PolyPhen 2 Score 0.030 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000117390
Gene: ENSMUSG00000005107
AA Change: I112L

DomainStartEndE-ValueType
Pfam:MFS_1 28 269 7.5e-14 PFAM
Pfam:Sugar_tr 40 260 2e-48 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000129099
AA Change: I97L

PolyPhen 2 Score 0.016 (Sensitivity: 0.95; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000122723
Gene: ENSMUSG00000005107
AA Change: I97L

DomainStartEndE-ValueType
Pfam:MFS_1 22 329 2.2e-16 PFAM
Pfam:Sugar_tr 25 480 2.5e-103 PFAM
Pfam:MFS_1 321 502 3.3e-10 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000143758
AA Change: I112L
SMART Domains Protein: ENSMUSP00000118430
Gene: ENSMUSG00000005107
AA Change: I112L

DomainStartEndE-ValueType
Pfam:MFS_1 37 223 4.2e-10 PFAM
Pfam:Sugar_tr 40 203 1.2e-35 PFAM
Pfam:Sugar_tr 206 388 5.8e-39 PFAM
Pfam:MFS_1 209 411 2.2e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000147664
AA Change: I97L

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000119586
Gene: ENSMUSG00000005107
AA Change: I97L

DomainStartEndE-ValueType
Pfam:Sugar_tr 25 143 9.8e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000155634
AA Change: I97L

PolyPhen 2 Score 0.016 (Sensitivity: 0.95; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000116354
Gene: ENSMUSG00000005107
AA Change: I97L

DomainStartEndE-ValueType
Pfam:MFS_1 22 329 2.2e-16 PFAM
Pfam:Sugar_tr 25 480 2.5e-103 PFAM
Pfam:MFS_1 321 502 3.3e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000156272
SMART Domains Protein: ENSMUSP00000144374
Gene: ENSMUSG00000005107

DomainStartEndE-ValueType
Pfam:Sugar_tr 40 111 4.5e-9 PFAM
transmembrane domain 140 157 N/A INTRINSIC
Meta Mutation Damage Score 0.0687 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.4%
Validation Efficiency 100% (70/70)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the SLC2A facilitative glucose transporter family. Members of this family play a significant role in maintaining glucose homeostasis. The encoded protein may play a role in the development and survival of chondrocytes in cartilage matrices. Two transcript variants encoding distinct isoforms have been identified for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele show partial prenatal lethality, polydipsia, hyperuricemia, hyperuricosuria and polyuria, and develop urate nephropathy, characterized by obstructive lithiasis, tubulointerstitial inflammation, cortical fibrosis, renal insufficiency and reduced male weight. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810046K07Rik C T 9: 51,290,181 D192N probably damaging Het
4932415D10Rik T C 10: 82,293,636 N1180S probably benign Het
Abca16 T C 7: 120,527,121 F1167L probably damaging Het
Abraxas2 G A 7: 132,874,965 A145T probably damaging Het
Acaca C T 11: 84,292,929 T32I probably benign Het
Adam6a A T 12: 113,545,050 N348Y possibly damaging Het
Ankdd1a C T 9: 65,508,061 A227T possibly damaging Het
Arhgef38 T C 3: 133,234,708 D39G possibly damaging Het
Arid5b T C 10: 68,097,582 D587G possibly damaging Het
Brwd1 A G 16: 96,007,941 V1963A probably benign Het
Ccdc136 T A 6: 29,410,205 L34Q probably damaging Het
Cdh2 T C 18: 16,774,522 Q53R probably benign Het
Celsr2 G A 3: 108,401,214 S1799L probably damaging Het
Cenpe A G 3: 135,230,175 E457G probably benign Het
Cmtm1 A T 8: 104,305,163 M283K possibly damaging Het
Dcdc5 T C 2: 106,368,171 noncoding transcript Het
Decr1 T A 4: 15,924,261 M220L probably benign Het
Dgkg T G 16: 22,519,561 D592A probably damaging Het
Dkkl1 T C 7: 45,211,438 Q39R probably benign Het
Dyrk1a T A 16: 94,659,514 C10S probably damaging Het
Efcab2 A T 1: 178,481,371 E146D probably benign Het
Efhc1 T C 1: 20,979,428 V504A possibly damaging Het
Ermard T G 17: 15,053,205 probably null Het
Espl1 T C 15: 102,315,812 V1266A probably benign Het
Fbxw22 A C 9: 109,403,397 V40G probably damaging Het
Gm3460 A T 14: 6,619,410 I194N possibly damaging Het
Gnai2 C T 9: 107,620,097 V33M possibly damaging Het
H2-DMb1 T C 17: 34,157,532 probably null Het
Hc T C 2: 34,989,839 probably null Het
Iars T C 13: 49,708,445 S491P probably damaging Het
Knl1 T A 2: 119,069,318 L500H probably damaging Het
Lamb1 A T 12: 31,269,147 T102S probably damaging Het
Lrrc7 A G 3: 158,160,736 S1123P probably damaging Het
Mettl5 C A 2: 69,871,727 probably null Het
Mmp11 A G 10: 75,923,984 *4R probably null Het
Myom1 A T 17: 71,082,488 D911V probably benign Het
Nid1 A G 13: 13,463,782 T96A probably benign Het
Nlrp4e G T 7: 23,353,172 V839L probably benign Het
Notch3 A T 17: 32,151,154 probably null Het
Olfr1082 T C 2: 86,594,067 T254A possibly damaging Het
Pcdh8 T C 14: 79,767,651 H978R probably benign Het
Pde8b A T 13: 95,042,000 C537* probably null Het
Polr1b T C 2: 129,125,446 F920L probably damaging Het
Polr2f A G 15: 79,151,373 T87A probably damaging Het
Pon2 T A 6: 5,272,421 H133L probably damaging Het
Ptk2b T A 14: 66,178,831 E205V probably damaging Het
Rb1cc1 T A 1: 6,244,133 M343K probably benign Het
Rlf G A 4: 121,148,610 R1058W probably damaging Het
S100z T A 13: 95,478,574 K28* probably null Het
Scarf1 T A 11: 75,520,315 N273K probably benign Het
Setd2 A G 9: 110,556,366 I136M unknown Het
Sfrp2 A G 3: 83,766,984 D148G probably benign Het
Slc24a4 A G 12: 102,254,510 E400G probably benign Het
Smc5 A T 19: 23,208,948 Y972* probably null Het
Sntg1 T C 1: 8,445,024 probably null Het
Stag1 A G 9: 100,757,733 D114G probably damaging Het
Suclg1 T C 6: 73,256,209 S46P probably damaging Het
Synj1 C T 16: 90,946,815 A1186T probably benign Het
Tas2r124 A G 6: 132,755,447 T240A probably benign Het
Tax1bp1 T C 6: 52,744,356 probably null Het
Tchh C A 3: 93,447,851 Q1533K unknown Het
Tmprss15 T C 16: 78,962,170 T887A probably benign Het
Ttn T C 2: 76,706,593 I34963V probably benign Het
Unc79 G A 12: 103,112,619 G1485D probably damaging Het
Usp9y G T Y: 1,385,355 H633N probably benign Homo
Vmn2r99 A T 17: 19,382,605 N541Y probably damaging Het
Zbtb11 T A 16: 55,990,491 N337K probably benign Het
Zfp260 T A 7: 30,104,842 C56S possibly damaging Het
Zfp457 C T 13: 67,292,682 E610K probably damaging Het
Other mutations in Slc2a9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02232:Slc2a9 APN 5 38436670 missense probably benign 0.19
IGL02505:Slc2a9 APN 5 38436659 missense possibly damaging 0.69
IGL03096:Slc2a9 APN 5 38351229 missense probably damaging 1.00
transporter9 UTSW 5 38382044 missense probably damaging 1.00
R0121:Slc2a9 UTSW 5 38398743 missense probably benign 0.00
R0395:Slc2a9 UTSW 5 38453169 missense probably damaging 1.00
R0599:Slc2a9 UTSW 5 38480144 start gained probably benign
R0610:Slc2a9 UTSW 5 38379942 missense probably damaging 1.00
R0993:Slc2a9 UTSW 5 38382063 missense probably damaging 1.00
R1166:Slc2a9 UTSW 5 38382041 critical splice donor site probably null
R1710:Slc2a9 UTSW 5 38382044 missense probably damaging 1.00
R2256:Slc2a9 UTSW 5 38453199 missense probably damaging 0.96
R2257:Slc2a9 UTSW 5 38453199 missense probably damaging 0.96
R4066:Slc2a9 UTSW 5 38483349 missense probably benign 0.03
R4193:Slc2a9 UTSW 5 38398706 missense probably damaging 1.00
R4502:Slc2a9 UTSW 5 38398811 missense probably benign 0.04
R4734:Slc2a9 UTSW 5 38382099 missense probably damaging 1.00
R4917:Slc2a9 UTSW 5 38417260 missense probably benign 0.01
R5218:Slc2a9 UTSW 5 38453181 missense probably damaging 1.00
R5885:Slc2a9 UTSW 5 38440674 missense probably damaging 1.00
R6983:Slc2a9 UTSW 5 38391721 missense probably damaging 1.00
R7173:Slc2a9 UTSW 5 38452871 splice site probably null
R7286:Slc2a9 UTSW 5 38453195 missense probably damaging 0.99
R7405:Slc2a9 UTSW 5 38391824 missense probably damaging 1.00
R7573:Slc2a9 UTSW 5 38417226 missense probably damaging 1.00
R7594:Slc2a9 UTSW 5 38351291 missense probably benign 0.00
R8212:Slc2a9 UTSW 5 38480059 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ACCTGCAGCAGACTAGAAGG -3'
(R):5'- GGGCAGAAATAACTAACTCCTTCTG -3'

Sequencing Primer
(F):5'- CTAGAAGGCCTGGACACTGG -3'
(R):5'- GCTTTTTGTTTCCAGTATATCAAGGC -3'
Posted On2018-04-02