Incidental Mutation 'R6313:Suclg1'
ID510517
Institutional Source Beutler Lab
Gene Symbol Suclg1
Ensembl Gene ENSMUSG00000052738
Gene Namesuccinate-CoA ligase, GDP-forming, alpha subunit
SynonymsSucla1, 1500000I01Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6313 (G1)
Quality Score225.009
Status Validated
Chromosome6
Chromosomal Location73248382-73276911 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 73256209 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 46 (S46P)
Ref Sequence ENSEMBL: ENSMUSP00000065113 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064740] [ENSMUST00000123159] [ENSMUST00000203632]
Predicted Effect probably damaging
Transcript: ENSMUST00000064740
AA Change: S46P

PolyPhen 2 Score 0.972 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000065113
Gene: ENSMUSG00000052738
AA Change: S46P

DomainStartEndE-ValueType
low complexity region 1 29 N/A INTRINSIC
CoA_binding 51 147 6.28e-35 SMART
Pfam:Succ_CoA_lig 193 336 6.7e-11 PFAM
Pfam:Ligase_CoA 199 324 9.3e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000123159
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127660
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173366
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173409
Predicted Effect probably damaging
Transcript: ENSMUST00000203632
AA Change: S45P

PolyPhen 2 Score 0.958 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000145246
Gene: ENSMUSG00000052738
AA Change: S45P

DomainStartEndE-ValueType
low complexity region 1 28 N/A INTRINSIC
PDB:1EUD|A 37 67 2e-12 PDB
SCOP:d1euca1 41 68 6e-13 SMART
Meta Mutation Damage Score 0.4121 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.4%
Validation Efficiency 100% (70/70)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the alpha subunit of the heterodimeric enzyme succinate coenzyme A ligase. This enzyme is targeted to the mitochondria and catalyzes the conversion of succinyl CoA and ADP or GDP to succinate and ATP or GTP. Mutations in this gene are the cause of the metabolic disorder fatal infantile lactic acidosis and mitochondrial DNA depletion. [provided by RefSeq, Feb 2010]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810046K07Rik C T 9: 51,290,181 D192N probably damaging Het
4932415D10Rik T C 10: 82,293,636 N1180S probably benign Het
Abca16 T C 7: 120,527,121 F1167L probably damaging Het
Abraxas2 G A 7: 132,874,965 A145T probably damaging Het
Acaca C T 11: 84,292,929 T32I probably benign Het
Adam6a A T 12: 113,545,050 N348Y possibly damaging Het
Ankdd1a C T 9: 65,508,061 A227T possibly damaging Het
Arhgef38 T C 3: 133,234,708 D39G possibly damaging Het
Arid5b T C 10: 68,097,582 D587G possibly damaging Het
Brwd1 A G 16: 96,007,941 V1963A probably benign Het
Ccdc136 T A 6: 29,410,205 L34Q probably damaging Het
Cdh2 T C 18: 16,774,522 Q53R probably benign Het
Celsr2 G A 3: 108,401,214 S1799L probably damaging Het
Cenpe A G 3: 135,230,175 E457G probably benign Het
Cmtm1 A T 8: 104,305,163 M283K possibly damaging Het
Dcdc5 T C 2: 106,368,171 noncoding transcript Het
Decr1 T A 4: 15,924,261 M220L probably benign Het
Dgkg T G 16: 22,519,561 D592A probably damaging Het
Dkkl1 T C 7: 45,211,438 Q39R probably benign Het
Dyrk1a T A 16: 94,659,514 C10S probably damaging Het
Efcab2 A T 1: 178,481,371 E146D probably benign Het
Efhc1 T C 1: 20,979,428 V504A possibly damaging Het
Ermard T G 17: 15,053,205 probably null Het
Espl1 T C 15: 102,315,812 V1266A probably benign Het
Fbxw22 A C 9: 109,403,397 V40G probably damaging Het
Gm3460 A T 14: 6,619,410 I194N possibly damaging Het
Gnai2 C T 9: 107,620,097 V33M possibly damaging Het
H2-DMb1 T C 17: 34,157,532 probably null Het
Hc T C 2: 34,989,839 probably null Het
Iars T C 13: 49,708,445 S491P probably damaging Het
Knl1 T A 2: 119,069,318 L500H probably damaging Het
Lamb1 A T 12: 31,269,147 T102S probably damaging Het
Lrrc7 A G 3: 158,160,736 S1123P probably damaging Het
Mettl5 C A 2: 69,871,727 probably null Het
Mmp11 A G 10: 75,923,984 *4R probably null Het
Myom1 A T 17: 71,082,488 D911V probably benign Het
Nid1 A G 13: 13,463,782 T96A probably benign Het
Nlrp4e G T 7: 23,353,172 V839L probably benign Het
Notch3 A T 17: 32,151,154 probably null Het
Olfr1082 T C 2: 86,594,067 T254A possibly damaging Het
Pcdh8 T C 14: 79,767,651 H978R probably benign Het
Pde8b A T 13: 95,042,000 C537* probably null Het
Polr1b T C 2: 129,125,446 F920L probably damaging Het
Polr2f A G 15: 79,151,373 T87A probably damaging Het
Pon2 T A 6: 5,272,421 H133L probably damaging Het
Ptk2b T A 14: 66,178,831 E205V probably damaging Het
Rb1cc1 T A 1: 6,244,133 M343K probably benign Het
Rlf G A 4: 121,148,610 R1058W probably damaging Het
S100z T A 13: 95,478,574 K28* probably null Het
Scarf1 T A 11: 75,520,315 N273K probably benign Het
Setd2 A G 9: 110,556,366 I136M unknown Het
Sfrp2 A G 3: 83,766,984 D148G probably benign Het
Slc24a4 A G 12: 102,254,510 E400G probably benign Het
Slc2a9 T G 5: 38,453,121 I112L probably benign Het
Smc5 A T 19: 23,208,948 Y972* probably null Het
Sntg1 T C 1: 8,445,024 probably null Het
Stag1 A G 9: 100,757,733 D114G probably damaging Het
Synj1 C T 16: 90,946,815 A1186T probably benign Het
Tas2r124 A G 6: 132,755,447 T240A probably benign Het
Tax1bp1 T C 6: 52,744,356 probably null Het
Tchh C A 3: 93,447,851 Q1533K unknown Het
Tmprss15 T C 16: 78,962,170 T887A probably benign Het
Ttn T C 2: 76,706,593 I34963V probably benign Het
Unc79 G A 12: 103,112,619 G1485D probably damaging Het
Usp9y G T Y: 1,385,355 H633N probably benign Homo
Vmn2r99 A T 17: 19,382,605 N541Y probably damaging Het
Zbtb11 T A 16: 55,990,491 N337K probably benign Het
Zfp260 T A 7: 30,104,842 C56S possibly damaging Het
Zfp457 C T 13: 67,292,682 E610K probably damaging Het
Other mutations in Suclg1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01864:Suclg1 APN 6 73264297 intron probably benign
IGL02657:Suclg1 APN 6 73260521 missense probably damaging 1.00
IGL03250:Suclg1 APN 6 73270992 missense probably benign 0.04
IGL03306:Suclg1 APN 6 73270992 missense probably benign 0.04
R0012:Suclg1 UTSW 6 73270997 missense possibly damaging 0.66
R0012:Suclg1 UTSW 6 73270997 missense possibly damaging 0.66
R0038:Suclg1 UTSW 6 73260503 missense probably benign 0.26
R0038:Suclg1 UTSW 6 73260503 missense probably benign 0.26
R0379:Suclg1 UTSW 6 73256228 missense possibly damaging 0.89
R0969:Suclg1 UTSW 6 73271116 missense probably benign 0.33
R1123:Suclg1 UTSW 6 73256227 missense probably benign 0.02
R2089:Suclg1 UTSW 6 73264276 missense probably benign 0.00
R2091:Suclg1 UTSW 6 73264276 missense probably benign 0.00
R2091:Suclg1 UTSW 6 73264276 missense probably benign 0.00
R5083:Suclg1 UTSW 6 73263980 missense probably benign
R6176:Suclg1 UTSW 6 73275343 missense probably damaging 1.00
R6338:Suclg1 UTSW 6 73264246 missense probably damaging 1.00
R7231:Suclg1 UTSW 6 73263971 missense probably benign 0.00
R7246:Suclg1 UTSW 6 73276713 missense unknown
R7250:Suclg1 UTSW 6 73271091 missense probably benign 0.00
R7524:Suclg1 UTSW 6 73263841 missense probably damaging 0.99
R7829:Suclg1 UTSW 6 73275243 intron probably null
Predicted Primers PCR Primer
(F):5'- GGCTGTGATCATAGCATTGCTC -3'
(R):5'- ACGGTATAGTTCTGTGCTATCATG -3'

Sequencing Primer
(F):5'- ATGGTGGCTCACAACCATCTG -3'
(R):5'- CATACCTGTTTGCCTGTG -3'
Posted On2018-04-02