Incidental Mutation 'R6313:Tas2r124'
ID510518
Institutional Source Beutler Lab
Gene Symbol Tas2r124
Ensembl Gene ENSMUSG00000060412
Gene Nametaste receptor, type 2, member 124
SynonymsT2R24, mGR24, mt2r50, Tas2r24
MMRRC Submission
Accession Numbers

NCBI RefSeq: NM_207026.1; MGI:2681267

Is this an essential gene? Probably non essential (E-score: 0.067) question?
Stock #R6313 (G1)
Quality Score225.009
Status Validated
Chromosome6
Chromosomal Location132754730-132755659 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 132755447 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 240 (T240A)
Ref Sequence ENSEMBL: ENSMUSP00000075509 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076150]
Predicted Effect probably benign
Transcript: ENSMUST00000076150
AA Change: T240A

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000075509
Gene: ENSMUSG00000060412
AA Change: T240A

DomainStartEndE-ValueType
Pfam:TAS2R 1 298 2.3e-92 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.4%
Validation Efficiency 100% (70/70)
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810046K07Rik C T 9: 51,290,181 D192N probably damaging Het
4932415D10Rik T C 10: 82,293,636 N1180S probably benign Het
Abca16 T C 7: 120,527,121 F1167L probably damaging Het
Abraxas2 G A 7: 132,874,965 A145T probably damaging Het
Acaca C T 11: 84,292,929 T32I probably benign Het
Adam6a A T 12: 113,545,050 N348Y possibly damaging Het
Ankdd1a C T 9: 65,508,061 A227T possibly damaging Het
Arhgef38 T C 3: 133,234,708 D39G possibly damaging Het
Arid5b T C 10: 68,097,582 D587G possibly damaging Het
Brwd1 A G 16: 96,007,941 V1963A probably benign Het
Ccdc136 T A 6: 29,410,205 L34Q probably damaging Het
Cdh2 T C 18: 16,774,522 Q53R probably benign Het
Celsr2 G A 3: 108,401,214 S1799L probably damaging Het
Cenpe A G 3: 135,230,175 E457G probably benign Het
Cmtm1 A T 8: 104,305,163 M283K possibly damaging Het
Dcdc5 T C 2: 106,368,171 noncoding transcript Het
Decr1 T A 4: 15,924,261 M220L probably benign Het
Dgkg T G 16: 22,519,561 D592A probably damaging Het
Dkkl1 T C 7: 45,211,438 Q39R probably benign Het
Dyrk1a T A 16: 94,659,514 C10S probably damaging Het
Efcab2 A T 1: 178,481,371 E146D probably benign Het
Efhc1 T C 1: 20,979,428 V504A possibly damaging Het
Ermard T G 17: 15,053,205 probably null Het
Espl1 T C 15: 102,315,812 V1266A probably benign Het
Fbxw22 A C 9: 109,403,397 V40G probably damaging Het
Gm3460 A T 14: 6,619,410 I194N possibly damaging Het
Gnai2 C T 9: 107,620,097 V33M possibly damaging Het
H2-DMb1 T C 17: 34,157,532 probably null Het
Hc T C 2: 34,989,839 probably null Het
Iars T C 13: 49,708,445 S491P probably damaging Het
Knl1 T A 2: 119,069,318 L500H probably damaging Het
Lamb1 A T 12: 31,269,147 T102S probably damaging Het
Lrrc7 A G 3: 158,160,736 S1123P probably damaging Het
Mettl5 C A 2: 69,871,727 probably null Het
Mmp11 A G 10: 75,923,984 *4R probably null Het
Myom1 A T 17: 71,082,488 D911V probably benign Het
Nid1 A G 13: 13,463,782 T96A probably benign Het
Nlrp4e G T 7: 23,353,172 V839L probably benign Het
Notch3 A T 17: 32,151,154 probably null Het
Olfr1082 T C 2: 86,594,067 T254A possibly damaging Het
Pcdh8 T C 14: 79,767,651 H978R probably benign Het
Pde8b A T 13: 95,042,000 C537* probably null Het
Polr1b T C 2: 129,125,446 F920L probably damaging Het
Polr2f A G 15: 79,151,373 T87A probably damaging Het
Pon2 T A 6: 5,272,421 H133L probably damaging Het
Ptk2b T A 14: 66,178,831 E205V probably damaging Het
Rb1cc1 T A 1: 6,244,133 M343K probably benign Het
Rlf G A 4: 121,148,610 R1058W probably damaging Het
S100z T A 13: 95,478,574 K28* probably null Het
Scarf1 T A 11: 75,520,315 N273K probably benign Het
Setd2 A G 9: 110,556,366 I136M unknown Het
Sfrp2 A G 3: 83,766,984 D148G probably benign Het
Slc24a4 A G 12: 102,254,510 E400G probably benign Het
Slc2a9 T G 5: 38,453,121 I112L probably benign Het
Smc5 A T 19: 23,208,948 Y972* probably null Het
Sntg1 T C 1: 8,445,024 probably null Het
Stag1 A G 9: 100,757,733 D114G probably damaging Het
Suclg1 T C 6: 73,256,209 S46P probably damaging Het
Synj1 C T 16: 90,946,815 A1186T probably benign Het
Tax1bp1 T C 6: 52,744,356 probably null Het
Tchh C A 3: 93,447,851 Q1533K unknown Het
Tmprss15 T C 16: 78,962,170 T887A probably benign Het
Ttn T C 2: 76,706,593 I34963V probably benign Het
Unc79 G A 12: 103,112,619 G1485D probably damaging Het
Usp9y G T Y: 1,385,355 H633N probably benign Homo
Vmn2r99 A T 17: 19,382,605 N541Y probably damaging Het
Zbtb11 T A 16: 55,990,491 N337K probably benign Het
Zfp260 T A 7: 30,104,842 C56S possibly damaging Het
Zfp457 C T 13: 67,292,682 E610K probably damaging Het
Other mutations in Tas2r124
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00985:Tas2r124 APN 6 132755529 missense probably benign 0.02
IGL01343:Tas2r124 APN 6 132755415 missense probably damaging 1.00
IGL01646:Tas2r124 APN 6 132755369 missense probably damaging 0.98
IGL01743:Tas2r124 APN 6 132754835 missense probably benign 0.01
IGL02251:Tas2r124 APN 6 132755561 missense probably benign 0.02
IGL03081:Tas2r124 APN 6 132755534 missense possibly damaging 0.61
IGL03309:Tas2r124 APN 6 132754935 missense probably benign 0.01
IGL03374:Tas2r124 APN 6 132755118 missense probably benign 0.00
P0012:Tas2r124 UTSW 6 132755540 missense possibly damaging 0.70
R1450:Tas2r124 UTSW 6 132755056 missense probably damaging 1.00
R1804:Tas2r124 UTSW 6 132755525 missense probably benign 0.11
R2048:Tas2r124 UTSW 6 132754895 missense possibly damaging 0.94
R2846:Tas2r124 UTSW 6 132755267 missense possibly damaging 0.73
R3415:Tas2r124 UTSW 6 132755638 missense probably benign 0.00
R3416:Tas2r124 UTSW 6 132755638 missense probably benign 0.00
R3417:Tas2r124 UTSW 6 132755638 missense probably benign 0.00
R4306:Tas2r124 UTSW 6 132754991 missense probably benign 0.03
R4308:Tas2r124 UTSW 6 132754991 missense probably benign 0.03
R4823:Tas2r124 UTSW 6 132755546 missense probably damaging 0.98
R4867:Tas2r124 UTSW 6 132755193 missense probably damaging 0.98
R4949:Tas2r124 UTSW 6 132754895 missense possibly damaging 0.94
R5242:Tas2r124 UTSW 6 132755540 missense possibly damaging 0.70
R6001:Tas2r124 UTSW 6 132755453 missense probably damaging 0.99
R6263:Tas2r124 UTSW 6 132754904 missense probably benign 0.45
R6394:Tas2r124 UTSW 6 132755076 missense probably damaging 1.00
R7685:Tas2r124 UTSW 6 132755093 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- AATTCCATGGAGACTGAGTTCTC -3'
(R):5'- GCTGCCTCATTACCCAAAGAGAG -3'

Sequencing Primer
(F):5'- CCATGGAGACTGAGTTCTCAATTTTG -3'
(R):5'- TCATTACCCAAAGAGAGGTCTG -3'
Posted On2018-04-02