Incidental Mutation 'R6313:Zfp260'
ID510520
Institutional Source Beutler Lab
Gene Symbol Zfp260
Ensembl Gene ENSMUSG00000049421
Gene Namezinc finger protein 260
SynonymsZfp63, PEX1, Ozrf1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.156) question?
Stock #R6313 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location30094777-30107622 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 30104842 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Serine at position 56 (C56S)
Ref Sequence ENSEMBL: ENSMUSP00000103835 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050735] [ENSMUST00000108200] [ENSMUST00000130526]
Predicted Effect possibly damaging
Transcript: ENSMUST00000050735
AA Change: C56S

PolyPhen 2 Score 0.864 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000052200
Gene: ENSMUSG00000049421
AA Change: C56S

DomainStartEndE-ValueType
ZnF_C2H2 23 45 6.78e-3 SMART
ZnF_C2H2 51 71 2.44e2 SMART
ZnF_C2H2 79 101 3.21e-4 SMART
ZnF_C2H2 131 153 5.59e-4 SMART
ZnF_C2H2 159 181 1.38e-3 SMART
ZnF_C2H2 187 209 9.88e-5 SMART
ZnF_C2H2 215 237 8.47e-4 SMART
ZnF_C2H2 243 265 1.6e-4 SMART
ZnF_C2H2 271 293 8.94e-3 SMART
ZnF_C2H2 299 321 3.21e-4 SMART
ZnF_C2H2 327 349 9.88e-5 SMART
ZnF_C2H2 355 377 1.38e-3 SMART
ZnF_C2H2 383 405 1.38e-3 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000108200
AA Change: C56S

PolyPhen 2 Score 0.864 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000103835
Gene: ENSMUSG00000049421
AA Change: C56S

DomainStartEndE-ValueType
ZnF_C2H2 23 45 6.78e-3 SMART
ZnF_C2H2 51 71 2.44e2 SMART
ZnF_C2H2 79 101 3.21e-4 SMART
ZnF_C2H2 131 153 5.59e-4 SMART
ZnF_C2H2 159 181 1.38e-3 SMART
ZnF_C2H2 187 209 9.88e-5 SMART
ZnF_C2H2 215 237 8.47e-4 SMART
ZnF_C2H2 243 265 1.6e-4 SMART
ZnF_C2H2 271 293 8.94e-3 SMART
ZnF_C2H2 299 321 3.21e-4 SMART
ZnF_C2H2 327 349 9.88e-5 SMART
ZnF_C2H2 355 377 1.38e-3 SMART
ZnF_C2H2 383 405 1.38e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000116939
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123095
Predicted Effect probably benign
Transcript: ENSMUST00000130526
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134365
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149302
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182136
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.4%
Validation Efficiency 100% (70/70)
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810046K07Rik C T 9: 51,290,181 D192N probably damaging Het
4932415D10Rik T C 10: 82,293,636 N1180S probably benign Het
Abca16 T C 7: 120,527,121 F1167L probably damaging Het
Abraxas2 G A 7: 132,874,965 A145T probably damaging Het
Acaca C T 11: 84,292,929 T32I probably benign Het
Adam6a A T 12: 113,545,050 N348Y possibly damaging Het
Ankdd1a C T 9: 65,508,061 A227T possibly damaging Het
Arhgef38 T C 3: 133,234,708 D39G possibly damaging Het
Arid5b T C 10: 68,097,582 D587G possibly damaging Het
Brwd1 A G 16: 96,007,941 V1963A probably benign Het
Ccdc136 T A 6: 29,410,205 L34Q probably damaging Het
Cdh2 T C 18: 16,774,522 Q53R probably benign Het
Celsr2 G A 3: 108,401,214 S1799L probably damaging Het
Cenpe A G 3: 135,230,175 E457G probably benign Het
Cmtm1 A T 8: 104,305,163 M283K possibly damaging Het
Dcdc5 T C 2: 106,368,171 noncoding transcript Het
Decr1 T A 4: 15,924,261 M220L probably benign Het
Dgkg T G 16: 22,519,561 D592A probably damaging Het
Dkkl1 T C 7: 45,211,438 Q39R probably benign Het
Dyrk1a T A 16: 94,659,514 C10S probably damaging Het
Efcab2 A T 1: 178,481,371 E146D probably benign Het
Efhc1 T C 1: 20,979,428 V504A possibly damaging Het
Ermard T G 17: 15,053,205 probably null Het
Espl1 T C 15: 102,315,812 V1266A probably benign Het
Fbxw22 A C 9: 109,403,397 V40G probably damaging Het
Gm3460 A T 14: 6,619,410 I194N possibly damaging Het
Gnai2 C T 9: 107,620,097 V33M possibly damaging Het
H2-DMb1 T C 17: 34,157,532 probably null Het
Hc T C 2: 34,989,839 probably null Het
Iars T C 13: 49,708,445 S491P probably damaging Het
Knl1 T A 2: 119,069,318 L500H probably damaging Het
Lamb1 A T 12: 31,269,147 T102S probably damaging Het
Lrrc7 A G 3: 158,160,736 S1123P probably damaging Het
Mettl5 C A 2: 69,871,727 probably null Het
Mmp11 A G 10: 75,923,984 *4R probably null Het
Myom1 A T 17: 71,082,488 D911V probably benign Het
Nid1 A G 13: 13,463,782 T96A probably benign Het
Nlrp4e G T 7: 23,353,172 V839L probably benign Het
Notch3 A T 17: 32,151,154 probably null Het
Olfr1082 T C 2: 86,594,067 T254A possibly damaging Het
Pcdh8 T C 14: 79,767,651 H978R probably benign Het
Pde8b A T 13: 95,042,000 C537* probably null Het
Polr1b T C 2: 129,125,446 F920L probably damaging Het
Polr2f A G 15: 79,151,373 T87A probably damaging Het
Pon2 T A 6: 5,272,421 H133L probably damaging Het
Ptk2b T A 14: 66,178,831 E205V probably damaging Het
Rb1cc1 T A 1: 6,244,133 M343K probably benign Het
Rlf G A 4: 121,148,610 R1058W probably damaging Het
S100z T A 13: 95,478,574 K28* probably null Het
Scarf1 T A 11: 75,520,315 N273K probably benign Het
Setd2 A G 9: 110,556,366 I136M unknown Het
Sfrp2 A G 3: 83,766,984 D148G probably benign Het
Slc24a4 A G 12: 102,254,510 E400G probably benign Het
Slc2a9 T G 5: 38,453,121 I112L probably benign Het
Smc5 A T 19: 23,208,948 Y972* probably null Het
Sntg1 T C 1: 8,445,024 probably null Het
Stag1 A G 9: 100,757,733 D114G probably damaging Het
Suclg1 T C 6: 73,256,209 S46P probably damaging Het
Synj1 C T 16: 90,946,815 A1186T probably benign Het
Tas2r124 A G 6: 132,755,447 T240A probably benign Het
Tax1bp1 T C 6: 52,744,356 probably null Het
Tchh C A 3: 93,447,851 Q1533K unknown Het
Tmprss15 T C 16: 78,962,170 T887A probably benign Het
Ttn T C 2: 76,706,593 I34963V probably benign Het
Unc79 G A 12: 103,112,619 G1485D probably damaging Het
Usp9y G T Y: 1,385,355 H633N probably benign Homo
Vmn2r99 A T 17: 19,382,605 N541Y probably damaging Het
Zbtb11 T A 16: 55,990,491 N337K probably benign Het
Zfp457 C T 13: 67,292,682 E610K probably damaging Het
Other mutations in Zfp260
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1739:Zfp260 UTSW 7 30104806 missense probably benign 0.04
R2143:Zfp260 UTSW 7 30105340 missense probably damaging 1.00
R2144:Zfp260 UTSW 7 30105340 missense probably damaging 1.00
R2145:Zfp260 UTSW 7 30105340 missense probably damaging 1.00
R2400:Zfp260 UTSW 7 30104701 missense possibly damaging 0.83
R3802:Zfp260 UTSW 7 30105079 missense probably benign 0.01
R5250:Zfp260 UTSW 7 30104967 missense probably damaging 1.00
R6416:Zfp260 UTSW 7 30104810 missense possibly damaging 0.58
R7369:Zfp260 UTSW 7 30105325 missense probably damaging 1.00
R7507:Zfp260 UTSW 7 30104866 missense probably damaging 0.99
R7920:Zfp260 UTSW 7 30105592 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TGGCAAAGCTTTCGTCCAGTC -3'
(R):5'- ACGGGAGTTTTCTTAGATTCACTG -3'

Sequencing Primer
(F):5'- CGTCCAGTCTCAGTAGATGCTAG -3'
(R):5'- AGATTCACTGGGTCTCTCTTCGG -3'
Posted On2018-04-02