Incidental Mutation 'R6313:Ankdd1a'
ID 510526
Institutional Source Beutler Lab
Gene Symbol Ankdd1a
Ensembl Gene ENSMUSG00000066510
Gene Name ankyrin repeat and death domain containing 1A
Synonyms LOC384945, EG330963
MMRRC Submission 044470-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.132) question?
Stock # R6313 (G1)
Quality Score 225.009
Status Validated
Chromosome 9
Chromosomal Location 65395752-65427475 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 65415343 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Alanine to Threonine at position 227 (A227T)
Ref Sequence ENSEMBL: ENSMUSP00000057040 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061766] [ENSMUST00000217646]
AlphaFold F8VQ39
Predicted Effect possibly damaging
Transcript: ENSMUST00000061766
AA Change: A227T

PolyPhen 2 Score 0.854 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000057040
Gene: ENSMUSG00000066510
AA Change: A227T

DomainStartEndE-ValueType
ANK 4 33 1.31e3 SMART
ANK 37 66 2.1e-3 SMART
ANK 70 99 6.26e-2 SMART
ANK 103 132 8.72e-1 SMART
ANK 138 167 5.09e-2 SMART
ANK 171 200 4.03e-5 SMART
ANK 204 233 5.32e-5 SMART
ANK 237 268 8.72e-1 SMART
ANK 270 299 8.99e-3 SMART
ANK 303 332 1.23e0 SMART
ANK 336 364 1.4e1 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000217646
AA Change: A237T

PolyPhen 2 Score 0.839 (Sensitivity: 0.84; Specificity: 0.93)
Meta Mutation Damage Score 0.1272 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.4%
Validation Efficiency 100% (70/70)
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca16 T C 7: 120,126,344 (GRCm39) F1167L probably damaging Het
Abraxas2 G A 7: 132,476,694 (GRCm39) A145T probably damaging Het
Acaca C T 11: 84,183,755 (GRCm39) T32I probably benign Het
Adam6a A T 12: 113,508,670 (GRCm39) N348Y possibly damaging Het
Arhgef38 T C 3: 132,940,469 (GRCm39) D39G possibly damaging Het
Arid5b T C 10: 67,933,412 (GRCm39) D587G possibly damaging Het
Brwd1 A G 16: 95,809,141 (GRCm39) V1963A probably benign Het
Ccdc136 T A 6: 29,410,204 (GRCm39) L34Q probably damaging Het
Cdh2 T C 18: 16,907,579 (GRCm39) Q53R probably benign Het
Celsr2 G A 3: 108,308,530 (GRCm39) S1799L probably damaging Het
Cenpe A G 3: 134,935,936 (GRCm39) E457G probably benign Het
Cmtm1 A T 8: 105,031,795 (GRCm39) M283K possibly damaging Het
Dcdc5 T C 2: 106,198,516 (GRCm39) noncoding transcript Het
Decr1 T A 4: 15,924,261 (GRCm39) M220L probably benign Het
Dgkg T G 16: 22,338,311 (GRCm39) D592A probably damaging Het
Dkkl1 T C 7: 44,860,862 (GRCm39) Q39R probably benign Het
Dyrk1a T A 16: 94,460,373 (GRCm39) C10S possibly damaging Het
Efcab2 A T 1: 178,308,936 (GRCm39) E146D probably benign Het
Efhc1 T C 1: 21,049,652 (GRCm39) V504A possibly damaging Het
Ermard T G 17: 15,273,467 (GRCm39) probably null Het
Espl1 T C 15: 102,224,247 (GRCm39) V1266A probably benign Het
Fbxw22 A C 9: 109,232,465 (GRCm39) V40G probably damaging Het
Gm3629 A T 14: 17,834,409 (GRCm39) I194N possibly damaging Het
Gnai2 C T 9: 107,497,296 (GRCm39) V33M possibly damaging Het
H2-DMb1 T C 17: 34,376,506 (GRCm39) probably null Het
Hc T C 2: 34,879,851 (GRCm39) probably null Het
Iars1 T C 13: 49,861,921 (GRCm39) S491P probably damaging Het
Knl1 T A 2: 118,899,799 (GRCm39) L500H probably damaging Het
Lamb1 A T 12: 31,319,146 (GRCm39) T102S probably damaging Het
Lrrc7 A G 3: 157,866,373 (GRCm39) S1123P probably damaging Het
Mettl5 C A 2: 69,702,071 (GRCm39) probably null Het
Mmp11 A G 10: 75,759,818 (GRCm39) *4R probably null Het
Myom1 A T 17: 71,389,483 (GRCm39) D911V probably benign Het
Nid1 A G 13: 13,638,367 (GRCm39) T96A probably benign Het
Nlrp4e G T 7: 23,052,597 (GRCm39) V839L probably benign Het
Notch3 A T 17: 32,370,128 (GRCm39) probably null Het
Or8k35 T C 2: 86,424,411 (GRCm39) T254A possibly damaging Het
Pcdh8 T C 14: 80,005,091 (GRCm39) H978R probably benign Het
Pde8b A T 13: 95,178,508 (GRCm39) C537* probably null Het
Polr1b T C 2: 128,967,366 (GRCm39) F920L probably damaging Het
Polr2f A G 15: 79,035,573 (GRCm39) T87A probably damaging Het
Pon2 T A 6: 5,272,421 (GRCm39) H133L probably damaging Het
Pou2af2 C T 9: 51,201,481 (GRCm39) D192N probably damaging Het
Ptk2b T A 14: 66,416,280 (GRCm39) E205V probably damaging Het
Rb1cc1 T A 1: 6,314,357 (GRCm39) M343K probably benign Het
Rlf G A 4: 121,005,807 (GRCm39) R1058W probably damaging Het
S100z T A 13: 95,615,082 (GRCm39) K28* probably null Het
Scarf1 T A 11: 75,411,141 (GRCm39) N273K probably benign Het
Setd2 A G 9: 110,385,434 (GRCm39) I136M unknown Het
Sfrp2 A G 3: 83,674,291 (GRCm39) D148G probably benign Het
Slc24a4 A G 12: 102,220,769 (GRCm39) E400G probably benign Het
Slc2a9 T G 5: 38,610,464 (GRCm39) I112L probably benign Het
Smc5 A T 19: 23,186,312 (GRCm39) Y972* probably null Het
Sntg1 T C 1: 8,515,248 (GRCm39) probably null Het
Spata31h1 T C 10: 82,129,470 (GRCm39) N1180S probably benign Het
Stag1 A G 9: 100,639,786 (GRCm39) D114G probably damaging Het
Suclg1 T C 6: 73,233,192 (GRCm39) S46P probably damaging Het
Synj1 C T 16: 90,743,703 (GRCm39) A1186T probably benign Het
Tas2r124 A G 6: 132,732,410 (GRCm39) T240A probably benign Het
Tax1bp1 T C 6: 52,721,341 (GRCm39) probably null Het
Tchh C A 3: 93,355,158 (GRCm39) Q1533K unknown Het
Tmprss15 T C 16: 78,759,058 (GRCm39) T887A probably benign Het
Ttn T C 2: 76,536,937 (GRCm39) I34963V probably benign Het
Unc79 G A 12: 103,078,878 (GRCm39) G1485D probably damaging Het
Usp9y G T Y: 1,385,355 (GRCm39) H633N probably benign Homo
Vmn2r99 A T 17: 19,602,867 (GRCm39) N541Y probably damaging Het
Zbtb11 T A 16: 55,810,854 (GRCm39) N337K probably benign Het
Zfp260 T A 7: 29,804,267 (GRCm39) C56S possibly damaging Het
Zfp457 C T 13: 67,440,746 (GRCm39) E610K probably damaging Het
Other mutations in Ankdd1a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01315:Ankdd1a APN 9 65,415,984 (GRCm39) missense probably damaging 1.00
IGL01372:Ankdd1a APN 9 65,411,421 (GRCm39) missense probably damaging 1.00
IGL01932:Ankdd1a APN 9 65,414,893 (GRCm39) splice site probably benign
IGL02150:Ankdd1a APN 9 65,420,001 (GRCm39) missense probably damaging 1.00
IGL03243:Ankdd1a APN 9 65,408,752 (GRCm39) missense probably benign 0.28
PIT4618001:Ankdd1a UTSW 9 65,414,932 (GRCm39) missense possibly damaging 0.76
R0137:Ankdd1a UTSW 9 65,417,610 (GRCm39) missense probably null 0.26
R0302:Ankdd1a UTSW 9 65,416,924 (GRCm39) splice site probably benign
R0980:Ankdd1a UTSW 9 65,424,253 (GRCm39) missense probably damaging 1.00
R1832:Ankdd1a UTSW 9 65,411,771 (GRCm39) critical splice donor site probably null
R3887:Ankdd1a UTSW 9 65,409,530 (GRCm39) missense probably damaging 1.00
R4470:Ankdd1a UTSW 9 65,410,791 (GRCm39) missense probably damaging 1.00
R4471:Ankdd1a UTSW 9 65,410,791 (GRCm39) missense probably damaging 1.00
R5326:Ankdd1a UTSW 9 65,411,472 (GRCm39) critical splice acceptor site probably null
R5394:Ankdd1a UTSW 9 65,412,496 (GRCm39) missense probably benign 0.12
R5542:Ankdd1a UTSW 9 65,411,472 (GRCm39) critical splice acceptor site probably null
R5594:Ankdd1a UTSW 9 65,409,523 (GRCm39) missense probably damaging 1.00
R5933:Ankdd1a UTSW 9 65,416,978 (GRCm39) missense probably benign 0.11
R6217:Ankdd1a UTSW 9 65,415,343 (GRCm39) missense possibly damaging 0.85
R6294:Ankdd1a UTSW 9 65,427,446 (GRCm39) missense probably benign 0.12
R6300:Ankdd1a UTSW 9 65,415,343 (GRCm39) missense possibly damaging 0.85
R6301:Ankdd1a UTSW 9 65,415,343 (GRCm39) missense possibly damaging 0.85
R6305:Ankdd1a UTSW 9 65,415,343 (GRCm39) missense possibly damaging 0.85
R6306:Ankdd1a UTSW 9 65,415,343 (GRCm39) missense possibly damaging 0.85
R6307:Ankdd1a UTSW 9 65,415,343 (GRCm39) missense possibly damaging 0.85
R6312:Ankdd1a UTSW 9 65,415,343 (GRCm39) missense possibly damaging 0.85
R6314:Ankdd1a UTSW 9 65,415,343 (GRCm39) missense possibly damaging 0.85
R6413:Ankdd1a UTSW 9 65,417,654 (GRCm39) missense probably benign
R6431:Ankdd1a UTSW 9 65,424,220 (GRCm39) missense possibly damaging 0.92
R6477:Ankdd1a UTSW 9 65,409,494 (GRCm39) missense probably benign 0.10
R6991:Ankdd1a UTSW 9 65,415,957 (GRCm39) missense probably benign 0.22
R7260:Ankdd1a UTSW 9 65,411,834 (GRCm39) missense probably damaging 0.96
R7586:Ankdd1a UTSW 9 65,409,466 (GRCm39) critical splice donor site probably null
R8680:Ankdd1a UTSW 9 65,412,418 (GRCm39) missense probably damaging 1.00
R8809:Ankdd1a UTSW 9 65,415,422 (GRCm39) splice site probably benign
R9562:Ankdd1a UTSW 9 65,411,452 (GRCm39) missense possibly damaging 0.62
R9565:Ankdd1a UTSW 9 65,411,452 (GRCm39) missense possibly damaging 0.62
R9772:Ankdd1a UTSW 9 65,408,749 (GRCm39) missense probably damaging 1.00
X0064:Ankdd1a UTSW 9 65,410,735 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ACAATGACTTTTGCTATGCCAC -3'
(R):5'- TTCCATCAGTGTGGGCTCAG -3'

Sequencing Primer
(F):5'- GCTATGCCACATTGCTAAGCCATG -3'
(R):5'- ACAGGTAACCAAGACTCTTGTTCTC -3'
Posted On 2018-04-02