Incidental Mutation 'R6313:Gnai2'
ID 510528
Institutional Source Beutler Lab
Gene Symbol Gnai2
Ensembl Gene ENSMUSG00000032562
Gene Name guanine nucleotide binding protein (G protein), alpha inhibiting 2
Synonyms Gia, Galphai2, Gnai-2
MMRRC Submission 044470-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.867) question?
Stock # R6313 (G1)
Quality Score 225.009
Status Validated
Chromosome 9
Chromosomal Location 107614125-107635367 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 107620097 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Methionine at position 33 (V33M)
Ref Sequence ENSEMBL: ENSMUSP00000141472 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055704] [ENSMUST00000192615] [ENSMUST00000192837] [ENSMUST00000193394]
AlphaFold P08752
Predicted Effect probably benign
Transcript: ENSMUST00000055704
AA Change: V85M

PolyPhen 2 Score 0.098 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000057543
Gene: ENSMUSG00000032562
AA Change: V85M

DomainStartEndE-ValueType
G_alpha 13 354 2.1e-219 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000192615
AA Change: V85M

PolyPhen 2 Score 0.098 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000142326
Gene: ENSMUSG00000032562
AA Change: V85M

DomainStartEndE-ValueType
G_alpha 13 354 2.1e-219 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000192837
SMART Domains Protein: ENSMUSP00000141929
Gene: ENSMUSG00000032562

DomainStartEndE-ValueType
PDB:4N0E|A 1 40 4e-18 PDB
Blast:G_alpha 13 85 9e-12 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000193372
Predicted Effect possibly damaging
Transcript: ENSMUST00000193394
AA Change: V33M

PolyPhen 2 Score 0.490 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000141472
Gene: ENSMUSG00000032562
AA Change: V33M

DomainStartEndE-ValueType
G_alpha 1 160 2.2e-16 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000193538
Predicted Effect noncoding transcript
Transcript: ENSMUST00000193835
Predicted Effect noncoding transcript
Transcript: ENSMUST00000195231
Predicted Effect noncoding transcript
Transcript: ENSMUST00000195762
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.4%
Validation Efficiency 100% (70/70)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is an alpha subunit of guanine nucleotide binding proteins (G proteins). The encoded protein contains the guanine nucleotide binding site and is involved in the hormonal regulation of adenylate cyclase. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2013]
PHENOTYPE: Nullizygous mice exhibit growth retardation, lethal ulcerative colitis, colon adenocarcinomas, granulocytosis, altered thymocyte maturation and function and enhanced production of pro-inflammatory cytokines, and may show alterations in leukocyte physiology and susceptibility to parasitic infection. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810046K07Rik C T 9: 51,290,181 D192N probably damaging Het
4932415D10Rik T C 10: 82,293,636 N1180S probably benign Het
Abca16 T C 7: 120,527,121 F1167L probably damaging Het
Abraxas2 G A 7: 132,874,965 A145T probably damaging Het
Acaca C T 11: 84,292,929 T32I probably benign Het
Adam6a A T 12: 113,545,050 N348Y possibly damaging Het
Ankdd1a C T 9: 65,508,061 A227T possibly damaging Het
Arhgef38 T C 3: 133,234,708 D39G possibly damaging Het
Arid5b T C 10: 68,097,582 D587G possibly damaging Het
Brwd1 A G 16: 96,007,941 V1963A probably benign Het
Ccdc136 T A 6: 29,410,205 L34Q probably damaging Het
Cdh2 T C 18: 16,774,522 Q53R probably benign Het
Celsr2 G A 3: 108,401,214 S1799L probably damaging Het
Cenpe A G 3: 135,230,175 E457G probably benign Het
Cmtm1 A T 8: 104,305,163 M283K possibly damaging Het
Dcdc5 T C 2: 106,368,171 noncoding transcript Het
Decr1 T A 4: 15,924,261 M220L probably benign Het
Dgkg T G 16: 22,519,561 D592A probably damaging Het
Dkkl1 T C 7: 45,211,438 Q39R probably benign Het
Dyrk1a T A 16: 94,659,514 C10S possibly damaging Het
Efcab2 A T 1: 178,481,371 E146D probably benign Het
Efhc1 T C 1: 20,979,428 V504A possibly damaging Het
Ermard T G 17: 15,053,205 probably null Het
Espl1 T C 15: 102,315,812 V1266A probably benign Het
Fbxw22 A C 9: 109,403,397 V40G probably damaging Het
Gm3460 A T 14: 6,619,410 I194N possibly damaging Het
H2-DMb1 T C 17: 34,157,532 probably null Het
Hc T C 2: 34,989,839 probably null Het
Iars T C 13: 49,708,445 S491P probably damaging Het
Knl1 T A 2: 119,069,318 L500H probably damaging Het
Lamb1 A T 12: 31,269,147 T102S probably damaging Het
Lrrc7 A G 3: 158,160,736 S1123P probably damaging Het
Mettl5 C A 2: 69,871,727 probably null Het
Mmp11 A G 10: 75,923,984 *4R probably null Het
Myom1 A T 17: 71,082,488 D911V probably benign Het
Nid1 A G 13: 13,463,782 T96A probably benign Het
Nlrp4e G T 7: 23,353,172 V839L probably benign Het
Notch3 A T 17: 32,151,154 probably null Het
Olfr1082 T C 2: 86,594,067 T254A possibly damaging Het
Pcdh8 T C 14: 79,767,651 H978R probably benign Het
Pde8b A T 13: 95,042,000 C537* probably null Het
Polr1b T C 2: 129,125,446 F920L probably damaging Het
Polr2f A G 15: 79,151,373 T87A probably damaging Het
Pon2 T A 6: 5,272,421 H133L probably damaging Het
Ptk2b T A 14: 66,178,831 E205V probably damaging Het
Rb1cc1 T A 1: 6,244,133 M343K probably benign Het
Rlf G A 4: 121,148,610 R1058W probably damaging Het
S100z T A 13: 95,478,574 K28* probably null Het
Scarf1 T A 11: 75,520,315 N273K probably benign Het
Setd2 A G 9: 110,556,366 I136M unknown Het
Sfrp2 A G 3: 83,766,984 D148G probably benign Het
Slc24a4 A G 12: 102,254,510 E400G probably benign Het
Slc2a9 T G 5: 38,453,121 I112L probably benign Het
Smc5 A T 19: 23,208,948 Y972* probably null Het
Sntg1 T C 1: 8,445,024 probably null Het
Stag1 A G 9: 100,757,733 D114G probably damaging Het
Suclg1 T C 6: 73,256,209 S46P probably damaging Het
Synj1 C T 16: 90,946,815 A1186T probably benign Het
Tas2r124 A G 6: 132,755,447 T240A probably benign Het
Tax1bp1 T C 6: 52,744,356 probably null Het
Tchh C A 3: 93,447,851 Q1533K unknown Het
Tmprss15 T C 16: 78,962,170 T887A probably benign Het
Ttn T C 2: 76,706,593 I34963V probably benign Het
Unc79 G A 12: 103,112,619 G1485D probably damaging Het
Usp9y G T Y: 1,385,355 H633N probably benign Homo
Vmn2r99 A T 17: 19,382,605 N541Y probably damaging Het
Zbtb11 T A 16: 55,990,491 N337K probably benign Het
Zfp260 T A 7: 30,104,842 C56S possibly damaging Het
Zfp457 C T 13: 67,292,682 E610K probably damaging Het
Other mutations in Gnai2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01760:Gnai2 APN 9 107616518 missense probably damaging 1.00
IGL02408:Gnai2 APN 9 107616194 missense probably benign
R0520:Gnai2 UTSW 9 107620173 missense probably benign 0.01
R1106:Gnai2 UTSW 9 107620186 missense probably damaging 1.00
R5443:Gnai2 UTSW 9 107620187 missense probably damaging 0.96
R5479:Gnai2 UTSW 9 107635166 missense probably benign 0.14
R6312:Gnai2 UTSW 9 107635117 missense probably damaging 1.00
R7240:Gnai2 UTSW 9 107615773 missense
R7748:Gnai2 UTSW 9 107615735 missense
R8696:Gnai2 UTSW 9 107619769 missense
R8862:Gnai2 UTSW 9 107635127 missense
R9320:Gnai2 UTSW 9 107615714 missense
R9799:Gnai2 UTSW 9 107635181 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- TCCCGATGATTAGAGAGCAGG -3'
(R):5'- TATCAATATGACTCTGTAGGCCAGG -3'

Sequencing Primer
(F):5'- GGAATATTCTAGAACAGGGCCC -3'
(R):5'- GCTGTTCCCCCTCTTTGGAGTAG -3'
Posted On 2018-04-02