Incidental Mutation 'R6313:Arid5b'
ID 510531
Institutional Source Beutler Lab
Gene Symbol Arid5b
Ensembl Gene ENSMUSG00000019947
Gene Name AT-rich interaction domain 5B
Synonyms Mrf2alpha, Mrf2beta, Mrf2, 5430435G07Rik, Desrt
MMRRC Submission 044470-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.941) question?
Stock # R6313 (G1)
Quality Score 225.009
Status Validated
Chromosome 10
Chromosomal Location 67928350-68114570 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 67933412 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 587 (D587G)
Ref Sequence ENSEMBL: ENSMUSP00000151665 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020106] [ENSMUST00000218532] [ENSMUST00000219238]
AlphaFold Q8BM75
Predicted Effect probably benign
Transcript: ENSMUST00000020106
SMART Domains Protein: ENSMUSP00000020106
Gene: ENSMUSG00000019947

DomainStartEndE-ValueType
ARID 316 407 8.29e-35 SMART
BRIGHT 320 412 4.18e-38 SMART
low complexity region 425 438 N/A INTRINSIC
low complexity region 451 462 N/A INTRINSIC
low complexity region 538 549 N/A INTRINSIC
low complexity region 695 718 N/A INTRINSIC
low complexity region 730 741 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000218532
AA Change: D587G

PolyPhen 2 Score 0.950 (Sensitivity: 0.79; Specificity: 0.95)
Predicted Effect possibly damaging
Transcript: ENSMUST00000219238
AA Change: D830G

PolyPhen 2 Score 0.916 (Sensitivity: 0.81; Specificity: 0.94)
Meta Mutation Damage Score 0.5633 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.4%
Validation Efficiency 100% (70/70)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the AT-rich interaction domain (ARID) family of DNA binding proteins. The encoded protein forms a histone H3K9Me2 demethylase complex with PHD finger protein 2 and regulates the transcription of target genes involved in adipogenesis and liver development. This gene also plays a role in cell growth and differentiation of B-lymphocyte progenitors, and single nucleotide polymorphisms in this gene are associated with acute lymphoblastic leukemia. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Sep 2011]
PHENOTYPE: Mice homozygous for disruptions in this gene experience a high level of mortality perinatally or earlier. Growth rates are low and mice remain small throughout live. There are abnormalities in various organ systems as well as the reproductive system. Fertility is reduced. [provided by MGI curators]
Allele List at MGI

All alleles(212) : Targeted, knock-out(2) Gene trapped(210)

Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca16 T C 7: 120,126,344 (GRCm39) F1167L probably damaging Het
Abraxas2 G A 7: 132,476,694 (GRCm39) A145T probably damaging Het
Acaca C T 11: 84,183,755 (GRCm39) T32I probably benign Het
Adam6a A T 12: 113,508,670 (GRCm39) N348Y possibly damaging Het
Ankdd1a C T 9: 65,415,343 (GRCm39) A227T possibly damaging Het
Arhgef38 T C 3: 132,940,469 (GRCm39) D39G possibly damaging Het
Brwd1 A G 16: 95,809,141 (GRCm39) V1963A probably benign Het
Ccdc136 T A 6: 29,410,204 (GRCm39) L34Q probably damaging Het
Cdh2 T C 18: 16,907,579 (GRCm39) Q53R probably benign Het
Celsr2 G A 3: 108,308,530 (GRCm39) S1799L probably damaging Het
Cenpe A G 3: 134,935,936 (GRCm39) E457G probably benign Het
Cmtm1 A T 8: 105,031,795 (GRCm39) M283K possibly damaging Het
Dcdc5 T C 2: 106,198,516 (GRCm39) noncoding transcript Het
Decr1 T A 4: 15,924,261 (GRCm39) M220L probably benign Het
Dgkg T G 16: 22,338,311 (GRCm39) D592A probably damaging Het
Dkkl1 T C 7: 44,860,862 (GRCm39) Q39R probably benign Het
Dyrk1a T A 16: 94,460,373 (GRCm39) C10S possibly damaging Het
Efcab2 A T 1: 178,308,936 (GRCm39) E146D probably benign Het
Efhc1 T C 1: 21,049,652 (GRCm39) V504A possibly damaging Het
Ermard T G 17: 15,273,467 (GRCm39) probably null Het
Espl1 T C 15: 102,224,247 (GRCm39) V1266A probably benign Het
Fbxw22 A C 9: 109,232,465 (GRCm39) V40G probably damaging Het
Gm3629 A T 14: 17,834,409 (GRCm39) I194N possibly damaging Het
Gnai2 C T 9: 107,497,296 (GRCm39) V33M possibly damaging Het
H2-DMb1 T C 17: 34,376,506 (GRCm39) probably null Het
Hc T C 2: 34,879,851 (GRCm39) probably null Het
Iars1 T C 13: 49,861,921 (GRCm39) S491P probably damaging Het
Knl1 T A 2: 118,899,799 (GRCm39) L500H probably damaging Het
Lamb1 A T 12: 31,319,146 (GRCm39) T102S probably damaging Het
Lrrc7 A G 3: 157,866,373 (GRCm39) S1123P probably damaging Het
Mettl5 C A 2: 69,702,071 (GRCm39) probably null Het
Mmp11 A G 10: 75,759,818 (GRCm39) *4R probably null Het
Myom1 A T 17: 71,389,483 (GRCm39) D911V probably benign Het
Nid1 A G 13: 13,638,367 (GRCm39) T96A probably benign Het
Nlrp4e G T 7: 23,052,597 (GRCm39) V839L probably benign Het
Notch3 A T 17: 32,370,128 (GRCm39) probably null Het
Or8k35 T C 2: 86,424,411 (GRCm39) T254A possibly damaging Het
Pcdh8 T C 14: 80,005,091 (GRCm39) H978R probably benign Het
Pde8b A T 13: 95,178,508 (GRCm39) C537* probably null Het
Polr1b T C 2: 128,967,366 (GRCm39) F920L probably damaging Het
Polr2f A G 15: 79,035,573 (GRCm39) T87A probably damaging Het
Pon2 T A 6: 5,272,421 (GRCm39) H133L probably damaging Het
Pou2af2 C T 9: 51,201,481 (GRCm39) D192N probably damaging Het
Ptk2b T A 14: 66,416,280 (GRCm39) E205V probably damaging Het
Rb1cc1 T A 1: 6,314,357 (GRCm39) M343K probably benign Het
Rlf G A 4: 121,005,807 (GRCm39) R1058W probably damaging Het
S100z T A 13: 95,615,082 (GRCm39) K28* probably null Het
Scarf1 T A 11: 75,411,141 (GRCm39) N273K probably benign Het
Setd2 A G 9: 110,385,434 (GRCm39) I136M unknown Het
Sfrp2 A G 3: 83,674,291 (GRCm39) D148G probably benign Het
Slc24a4 A G 12: 102,220,769 (GRCm39) E400G probably benign Het
Slc2a9 T G 5: 38,610,464 (GRCm39) I112L probably benign Het
Smc5 A T 19: 23,186,312 (GRCm39) Y972* probably null Het
Sntg1 T C 1: 8,515,248 (GRCm39) probably null Het
Spata31h1 T C 10: 82,129,470 (GRCm39) N1180S probably benign Het
Stag1 A G 9: 100,639,786 (GRCm39) D114G probably damaging Het
Suclg1 T C 6: 73,233,192 (GRCm39) S46P probably damaging Het
Synj1 C T 16: 90,743,703 (GRCm39) A1186T probably benign Het
Tas2r124 A G 6: 132,732,410 (GRCm39) T240A probably benign Het
Tax1bp1 T C 6: 52,721,341 (GRCm39) probably null Het
Tchh C A 3: 93,355,158 (GRCm39) Q1533K unknown Het
Tmprss15 T C 16: 78,759,058 (GRCm39) T887A probably benign Het
Ttn T C 2: 76,536,937 (GRCm39) I34963V probably benign Het
Unc79 G A 12: 103,078,878 (GRCm39) G1485D probably damaging Het
Usp9y G T Y: 1,385,355 (GRCm39) H633N probably benign Homo
Vmn2r99 A T 17: 19,602,867 (GRCm39) N541Y probably damaging Het
Zbtb11 T A 16: 55,810,854 (GRCm39) N337K probably benign Het
Zfp260 T A 7: 29,804,267 (GRCm39) C56S possibly damaging Het
Zfp457 C T 13: 67,440,746 (GRCm39) E610K probably damaging Het
Other mutations in Arid5b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00229:Arid5b APN 10 67,964,805 (GRCm39) missense probably damaging 0.96
IGL01731:Arid5b APN 10 67,933,439 (GRCm39) missense probably damaging 1.00
IGL02069:Arid5b APN 10 67,933,229 (GRCm39) missense probably damaging 1.00
IGL02161:Arid5b APN 10 67,932,498 (GRCm39) missense probably benign 0.00
IGL02555:Arid5b APN 10 67,937,734 (GRCm39) missense probably benign 0.01
IGL02873:Arid5b APN 10 67,937,780 (GRCm39) missense probably benign 0.06
IGL03119:Arid5b APN 10 68,079,057 (GRCm39) missense probably damaging 1.00
IGL03271:Arid5b APN 10 67,933,287 (GRCm39) missense possibly damaging 0.73
gobi UTSW 10 67,954,175 (GRCm39) missense possibly damaging 0.92
3-1:Arid5b UTSW 10 67,934,419 (GRCm39) missense probably damaging 1.00
PIT4677001:Arid5b UTSW 10 67,933,841 (GRCm39) missense probably damaging 0.99
R0108:Arid5b UTSW 10 68,114,559 (GRCm39) utr 5 prime probably benign
R0525:Arid5b UTSW 10 67,933,676 (GRCm39) missense possibly damaging 0.90
R0533:Arid5b UTSW 10 68,021,863 (GRCm39) missense probably damaging 1.00
R0646:Arid5b UTSW 10 67,932,807 (GRCm39) missense probably damaging 1.00
R1066:Arid5b UTSW 10 67,934,186 (GRCm39) missense probably benign 0.04
R1487:Arid5b UTSW 10 67,933,044 (GRCm39) nonsense probably null
R1638:Arid5b UTSW 10 68,113,777 (GRCm39) missense possibly damaging 0.48
R1789:Arid5b UTSW 10 68,021,897 (GRCm39) missense probably damaging 0.99
R2031:Arid5b UTSW 10 68,114,518 (GRCm39) critical splice donor site probably null
R2337:Arid5b UTSW 10 67,933,607 (GRCm39) missense possibly damaging 0.63
R2996:Arid5b UTSW 10 67,934,292 (GRCm39) missense probably benign 0.01
R2997:Arid5b UTSW 10 67,934,292 (GRCm39) missense probably benign 0.01
R3547:Arid5b UTSW 10 67,934,292 (GRCm39) missense probably benign 0.01
R4411:Arid5b UTSW 10 67,932,519 (GRCm39) missense probably damaging 1.00
R4860:Arid5b UTSW 10 68,078,925 (GRCm39) missense probably damaging 0.97
R4860:Arid5b UTSW 10 68,078,925 (GRCm39) missense probably damaging 0.97
R5219:Arid5b UTSW 10 68,113,940 (GRCm39) missense probably benign 0.08
R5341:Arid5b UTSW 10 68,113,957 (GRCm39) missense possibly damaging 0.87
R5434:Arid5b UTSW 10 67,932,719 (GRCm39) missense possibly damaging 0.67
R5757:Arid5b UTSW 10 67,937,909 (GRCm39) missense probably damaging 1.00
R6114:Arid5b UTSW 10 67,933,574 (GRCm39) missense possibly damaging 0.89
R6338:Arid5b UTSW 10 67,934,391 (GRCm39) nonsense probably null
R6525:Arid5b UTSW 10 67,933,496 (GRCm39) missense possibly damaging 0.47
R6915:Arid5b UTSW 10 68,022,042 (GRCm39) nonsense probably null
R7013:Arid5b UTSW 10 67,933,649 (GRCm39) missense probably damaging 1.00
R7099:Arid5b UTSW 10 67,934,009 (GRCm39) missense probably damaging 1.00
R7260:Arid5b UTSW 10 67,933,637 (GRCm39) missense probably damaging 1.00
R7324:Arid5b UTSW 10 67,964,752 (GRCm39) missense probably benign 0.44
R7334:Arid5b UTSW 10 68,079,007 (GRCm39) missense possibly damaging 0.61
R7432:Arid5b UTSW 10 67,954,096 (GRCm39) missense probably damaging 1.00
R7453:Arid5b UTSW 10 68,078,994 (GRCm39) missense probably benign 0.01
R7649:Arid5b UTSW 10 67,954,175 (GRCm39) missense possibly damaging 0.92
R7659:Arid5b UTSW 10 67,934,417 (GRCm39) missense probably benign
R7661:Arid5b UTSW 10 67,934,417 (GRCm39) missense probably benign
R7662:Arid5b UTSW 10 67,934,417 (GRCm39) missense probably benign
R7663:Arid5b UTSW 10 67,934,417 (GRCm39) missense probably benign
R7665:Arid5b UTSW 10 67,934,417 (GRCm39) missense probably benign
R7666:Arid5b UTSW 10 67,934,417 (GRCm39) missense probably benign
R7759:Arid5b UTSW 10 67,933,632 (GRCm39) missense probably damaging 1.00
R7779:Arid5b UTSW 10 67,932,606 (GRCm39) missense probably damaging 1.00
R7788:Arid5b UTSW 10 67,934,417 (GRCm39) missense probably benign
R7789:Arid5b UTSW 10 67,934,417 (GRCm39) missense probably benign
R7875:Arid5b UTSW 10 67,964,771 (GRCm39) missense probably benign 0.02
R8079:Arid5b UTSW 10 67,934,186 (GRCm39) missense possibly damaging 0.88
R8096:Arid5b UTSW 10 68,021,982 (GRCm39) missense probably benign 0.00
R8228:Arid5b UTSW 10 68,114,536 (GRCm39) missense possibly damaging 0.95
R8377:Arid5b UTSW 10 67,933,217 (GRCm39) missense probably damaging 0.96
R8757:Arid5b UTSW 10 67,933,640 (GRCm39) missense probably damaging 1.00
R8910:Arid5b UTSW 10 67,934,108 (GRCm39) missense
R8954:Arid5b UTSW 10 67,937,810 (GRCm39) missense possibly damaging 0.88
R9234:Arid5b UTSW 10 67,964,628 (GRCm39) missense possibly damaging 0.82
R9272:Arid5b UTSW 10 67,937,882 (GRCm39) missense probably damaging 0.99
R9430:Arid5b UTSW 10 68,022,087 (GRCm39) critical splice acceptor site probably null
X0066:Arid5b UTSW 10 67,954,132 (GRCm39) missense probably damaging 1.00
Z1177:Arid5b UTSW 10 67,933,058 (GRCm39) missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TGGGAAGGCTCAGATCTGTG -3'
(R):5'- TCTTCAAGCACGACAAACTGAG -3'

Sequencing Primer
(F):5'- ATCATCGGTAGAGGCTTCTGC -3'
(R):5'- ACAAACTGAGCCGGTCCGATG -3'
Posted On 2018-04-02