Mutagenetix > Incidental Mutation

Incidental Mutation 'R6313:Arid5b'

510531

Institutional Source

Beutler Lab

Gene Symbol

Arid5b

Ensembl Gene

ENSMUSG00000019947

Gene Name

AT rich interactive domain 5B (MRF1-like)

Synonyms

5430435G07Rik, Mrf2beta, Mrf2alpha, Mrf2, Desrt

MMRRC Submission

Accession Numbers

Genbank: NM_023598; MGI: 2175912

Essential gene?

Probably essential (E-score: 0.922) question?

Stock #

R6313 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

68092520-68278740 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 68097582 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 587 (D587G)

Ref Sequence

ENSEMBL: ENSMUSP00000151665 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000020106] [ENSMUST00000218532] [ENSMUST00000219238]

AlphaFold

Q8BM75

Predicted Effect

probably benign
Transcript: ENSMUST00000020106

SMART Domains

Protein: ENSMUSP00000020106
Gene: ENSMUSG00000019947

Domain	Start	End	E-Value	Type
ARID	316	407	8.29e-35	SMART
BRIGHT	320	412	4.18e-38	SMART
low complexity region	425	438	N/A	INTRINSIC
low complexity region	451	462	N/A	INTRINSIC
low complexity region	538	549	N/A	INTRINSIC
low complexity region	695	718	N/A	INTRINSIC
low complexity region	730	741	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000218532
AA Change: D587G

PolyPhen 2 Score 0.950 (Sensitivity: 0.79; Specificity: 0.95)

Predicted Effect

possibly damaging
Transcript: ENSMUST00000219238
AA Change: D830G

PolyPhen 2 Score 0.916 (Sensitivity: 0.81; Specificity: 0.94)

Meta Mutation Damage Score

0.5633

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.5%
20x: 98.4%

Validation Efficiency

100% (70/70)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the AT-rich interaction domain (ARID) family of DNA binding proteins. The encoded protein forms a histone H3K9Me2 demethylase complex with PHD finger protein 2 and regulates the transcription of target genes involved in adipogenesis and liver development. This gene also plays a role in cell growth and differentiation of B-lymphocyte progenitors, and single nucleotide polymorphisms in this gene are associated with acute lymphoblastic leukemia. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Sep 2011]
PHENOTYPE: Mice homozygous for disruptions in this gene experience a high level of mortality perinatally or earlier. Growth rates are low and mice remain small throughout live. There are abnormalities in various organ systems as well as the reproductive system. Fertility is reduced. [provided by MGI curators]

Allele List at MGI

All alleles(212) : Targeted, knock-out(2) Gene trapped(210)

Other mutations in this stock

Total: 69 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1810046K07Rik	C	T	9: 51,290,181	D192N	probably damaging	Het
4932415D10Rik	T	C	10: 82,293,636	N1180S	probably benign	Het
Abca16	T	C	7: 120,527,121	F1167L	probably damaging	Het
Abraxas2	G	A	7: 132,874,965	A145T	probably damaging	Het
Acaca	C	T	11: 84,292,929	T32I	probably benign	Het
Adam6a	A	T	12: 113,545,050	N348Y	possibly damaging	Het
Ankdd1a	C	T	9: 65,508,061	A227T	possibly damaging	Het
Arhgef38	T	C	3: 133,234,708	D39G	possibly damaging	Het
Brwd1	A	G	16: 96,007,941	V1963A	probably benign	Het
Ccdc136	T	A	6: 29,410,205	L34Q	probably damaging	Het
Cdh2	T	C	18: 16,774,522	Q53R	probably benign	Het
Celsr2	G	A	3: 108,401,214	S1799L	probably damaging	Het
Cenpe	A	G	3: 135,230,175	E457G	probably benign	Het
Cmtm1	A	T	8: 104,305,163	M283K	possibly damaging	Het
Dcdc5	T	C	2: 106,368,171		noncoding transcript	Het
Decr1	T	A	4: 15,924,261	M220L	probably benign	Het
Dgkg	T	G	16: 22,519,561	D592A	probably damaging	Het
Dkkl1	T	C	7: 45,211,438	Q39R	probably benign	Het
Dyrk1a	T	A	16: 94,659,514	C10S	possibly damaging	Het
Efcab2	A	T	1: 178,481,371	E146D	probably benign	Het
Efhc1	T	C	1: 20,979,428	V504A	possibly damaging	Het
Ermard	T	G	17: 15,053,205		probably null	Het
Espl1	T	C	15: 102,315,812	V1266A	probably benign	Het
Fbxw22	A	C	9: 109,403,397	V40G	probably damaging	Het
Gm3460	A	T	14: 6,619,410	I194N	possibly damaging	Het
Gnai2	C	T	9: 107,620,097	V33M	possibly damaging	Het
H2-DMb1	T	C	17: 34,157,532		probably null	Het
Hc	T	C	2: 34,989,839		probably null	Het
Iars	T	C	13: 49,708,445	S491P	probably damaging	Het
Knl1	T	A	2: 119,069,318	L500H	probably damaging	Het
Lamb1	A	T	12: 31,269,147	T102S	probably damaging	Het
Lrrc7	A	G	3: 158,160,736	S1123P	probably damaging	Het
Mettl5	C	A	2: 69,871,727		probably null	Het
Mmp11	A	G	10: 75,923,984	*4R	probably null	Het
Myom1	A	T	17: 71,082,488	D911V	probably benign	Het
Nid1	A	G	13: 13,463,782	T96A	probably benign	Het
Nlrp4e	G	T	7: 23,353,172	V839L	probably benign	Het
Notch3	A	T	17: 32,151,154		probably null	Het
Olfr1082	T	C	2: 86,594,067	T254A	possibly damaging	Het
Pcdh8	T	C	14: 79,767,651	H978R	probably benign	Het
Pde8b	A	T	13: 95,042,000	C537*	probably null	Het
Polr1b	T	C	2: 129,125,446	F920L	probably damaging	Het
Polr2f	A	G	15: 79,151,373	T87A	probably damaging	Het
Pon2	T	A	6: 5,272,421	H133L	probably damaging	Het
Ptk2b	T	A	14: 66,178,831	E205V	probably damaging	Het
Rb1cc1	T	A	1: 6,244,133	M343K	probably benign	Het
Rlf	G	A	4: 121,148,610	R1058W	probably damaging	Het
S100z	T	A	13: 95,478,574	K28*	probably null	Het
Scarf1	T	A	11: 75,520,315	N273K	probably benign	Het
Setd2	A	G	9: 110,556,366	I136M	unknown	Het
Sfrp2	A	G	3: 83,766,984	D148G	probably benign	Het
Slc24a4	A	G	12: 102,254,510	E400G	probably benign	Het
Slc2a9	T	G	5: 38,453,121	I112L	probably benign	Het
Smc5	A	T	19: 23,208,948	Y972*	probably null	Het
Sntg1	T	C	1: 8,445,024		probably null	Het
Stag1	A	G	9: 100,757,733	D114G	probably damaging	Het
Suclg1	T	C	6: 73,256,209	S46P	probably damaging	Het
Synj1	C	T	16: 90,946,815	A1186T	probably benign	Het
Tas2r124	A	G	6: 132,755,447	T240A	probably benign	Het
Tax1bp1	T	C	6: 52,744,356		probably null	Het
Tchh	C	A	3: 93,447,851	Q1533K	unknown	Het
Tmprss15	T	C	16: 78,962,170	T887A	probably benign	Het
Ttn	T	C	2: 76,706,593	I34963V	probably benign	Het
Unc79	G	A	12: 103,112,619	G1485D	probably damaging	Het
Usp9y	G	T	Y: 1,385,355	H633N	probably benign	Homo
Vmn2r99	A	T	17: 19,382,605	N541Y	probably damaging	Het
Zbtb11	T	A	16: 55,990,491	N337K	probably benign	Het
Zfp260	T	A	7: 30,104,842	C56S	possibly damaging	Het
Zfp457	C	T	13: 67,292,682	E610K	probably damaging	Het

Other mutations in Arid5b

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00229:Arid5b	APN	10	68128975	missense	probably damaging	0.96
IGL01731:Arid5b	APN	10	68097609	missense	probably damaging	1.00
IGL02069:Arid5b	APN	10	68097399	missense	probably damaging	1.00
IGL02161:Arid5b	APN	10	68096668	missense	probably benign	0.00
IGL02555:Arid5b	APN	10	68101904	missense	probably benign	0.01
IGL02873:Arid5b	APN	10	68101950	missense	probably benign	0.06
IGL03119:Arid5b	APN	10	68243227	missense	probably damaging	1.00
IGL03271:Arid5b	APN	10	68097457	missense	possibly damaging	0.73
gobi	UTSW	10	68118345	missense	possibly damaging	0.92
3-1:Arid5b	UTSW	10	68098589	missense	probably damaging	1.00
PIT4677001:Arid5b	UTSW	10	68098011	missense	probably damaging	0.99
R0108:Arid5b	UTSW	10	68278729	utr 5 prime	probably benign
R0525:Arid5b	UTSW	10	68097846	missense	possibly damaging	0.90
R0533:Arid5b	UTSW	10	68186033	missense	probably damaging	1.00
R0646:Arid5b	UTSW	10	68096977	missense	probably damaging	1.00
R1066:Arid5b	UTSW	10	68098356	missense	probably benign	0.04
R1487:Arid5b	UTSW	10	68097214	nonsense	probably null
R1638:Arid5b	UTSW	10	68277947	missense	possibly damaging	0.48
R1789:Arid5b	UTSW	10	68186067	missense	probably damaging	0.99
R2031:Arid5b	UTSW	10	68278688	critical splice donor site	probably null
R2337:Arid5b	UTSW	10	68097777	missense	possibly damaging	0.63
R2996:Arid5b	UTSW	10	68098462	missense	probably benign	0.01
R2997:Arid5b	UTSW	10	68098462	missense	probably benign	0.01
R3547:Arid5b	UTSW	10	68098462	missense	probably benign	0.01
R4411:Arid5b	UTSW	10	68096689	missense	probably damaging	1.00
R4860:Arid5b	UTSW	10	68243095	missense	probably damaging	0.97
R4860:Arid5b	UTSW	10	68243095	missense	probably damaging	0.97
R5219:Arid5b	UTSW	10	68278110	missense	probably benign	0.08
R5341:Arid5b	UTSW	10	68278127	missense	possibly damaging	0.87
R5434:Arid5b	UTSW	10	68096889	missense	possibly damaging	0.67
R5757:Arid5b	UTSW	10	68102079	missense	probably damaging	1.00
R6114:Arid5b	UTSW	10	68097744	missense	possibly damaging	0.89
R6338:Arid5b	UTSW	10	68098561	nonsense	probably null
R6525:Arid5b	UTSW	10	68097666	missense	possibly damaging	0.47
R6915:Arid5b	UTSW	10	68186212	nonsense	probably null
R7013:Arid5b	UTSW	10	68097819	missense	probably damaging	1.00
R7099:Arid5b	UTSW	10	68098179	missense	probably damaging	1.00
R7260:Arid5b	UTSW	10	68097807	missense	probably damaging	1.00
R7324:Arid5b	UTSW	10	68128922	missense	probably benign	0.44
R7334:Arid5b	UTSW	10	68243177	missense	possibly damaging	0.61
R7432:Arid5b	UTSW	10	68118266	missense	probably damaging	1.00
R7453:Arid5b	UTSW	10	68243164	missense	probably benign	0.01
R7649:Arid5b	UTSW	10	68118345	missense	possibly damaging	0.92
R7659:Arid5b	UTSW	10	68098587	missense	probably benign
R7661:Arid5b	UTSW	10	68098587	missense	probably benign
R7662:Arid5b	UTSW	10	68098587	missense	probably benign
R7663:Arid5b	UTSW	10	68098587	missense	probably benign
R7665:Arid5b	UTSW	10	68098587	missense	probably benign
R7666:Arid5b	UTSW	10	68098587	missense	probably benign
R7759:Arid5b	UTSW	10	68097802	missense	probably damaging	1.00
R7779:Arid5b	UTSW	10	68096776	missense	probably damaging	1.00
R7788:Arid5b	UTSW	10	68098587	missense	probably benign
R7789:Arid5b	UTSW	10	68098587	missense	probably benign
R7875:Arid5b	UTSW	10	68128941	missense	probably benign	0.02
R8079:Arid5b	UTSW	10	68098356	missense	possibly damaging	0.88
R8096:Arid5b	UTSW	10	68186152	missense	probably benign	0.00
R8228:Arid5b	UTSW	10	68278706	missense	possibly damaging	0.95
R8377:Arid5b	UTSW	10	68097387	missense	probably damaging	0.96
R8757:Arid5b	UTSW	10	68097810	missense	probably damaging	1.00
R8910:Arid5b	UTSW	10	68098278	missense
R8954:Arid5b	UTSW	10	68101980	missense	possibly damaging	0.88
R9234:Arid5b	UTSW	10	68128798	missense	possibly damaging	0.82
R9272:Arid5b	UTSW	10	68102052	missense	probably damaging	0.99
R9430:Arid5b	UTSW	10	68186257	critical splice acceptor site	probably null
X0066:Arid5b	UTSW	10	68118302	missense	probably damaging	1.00
Z1177:Arid5b	UTSW	10	68097228	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- TGGGAAGGCTCAGATCTGTG -3'
(R):5'- TCTTCAAGCACGACAAACTGAG -3'

Sequencing Primer
(F):5'- ATCATCGGTAGAGGCTTCTGC -3'
(R):5'- ACAAACTGAGCCGGTCCGATG -3'

Posted On

2018-04-02