Mutagenetix > Incidental Mutation

Incidental Mutation 'R6313:Unc79'

510538

Institutional Source

Beutler Lab

Gene Symbol

Unc79

Ensembl Gene

ENSMUSG00000021198

Gene Name

unc-79 homolog (C. elegans)

Synonyms

9030205A07Rik, Mlca3

MMRRC Submission

044470-MU

Accession Numbers

Genbank: NM_001081017; MGI: 2684729; Ensembl: ENSMUST00000085079

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R6313 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

102948859-103184065 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 103112619 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glycine to Aspartic acid at position 1485 (G1485D)

Ref Sequence

ENSEMBL: ENSMUSP00000082156 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000085079] [ENSMUST00000101099] [ENSMUST00000178076] [ENSMUST00000179002]

AlphaFold

Q0KK59

Predicted Effect

probably damaging
Transcript: ENSMUST00000085079
AA Change: G1485D

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000082156
Gene: ENSMUSG00000021198
AA Change: G1485D

Domain	Start	End	E-Value	Type
Pfam:UNC-79	1	469	3.1e-223	PFAM
low complexity region	732	737	N/A	INTRINSIC
low complexity region	846	862	N/A	INTRINSIC
low complexity region	968	977	N/A	INTRINSIC
low complexity region	1114	1125	N/A	INTRINSIC
low complexity region	1313	1325	N/A	INTRINSIC
low complexity region	1428	1440	N/A	INTRINSIC
low complexity region	1471	1476	N/A	INTRINSIC
low complexity region	1477	1489	N/A	INTRINSIC
low complexity region	1490	1504	N/A	INTRINSIC
low complexity region	1541	1556	N/A	INTRINSIC
low complexity region	1861	1870	N/A	INTRINSIC
low complexity region	2237	2246	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000101099
AA Change: G1662D

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000098659
Gene: ENSMUSG00000021198
AA Change: G1662D

Domain	Start	End	E-Value	Type
Pfam:UNC-79	113	646	1.2e-226	PFAM
low complexity region	909	914	N/A	INTRINSIC
low complexity region	1023	1039	N/A	INTRINSIC
low complexity region	1145	1154	N/A	INTRINSIC
low complexity region	1291	1302	N/A	INTRINSIC
low complexity region	1490	1502	N/A	INTRINSIC
low complexity region	1605	1617	N/A	INTRINSIC
low complexity region	1648	1653	N/A	INTRINSIC
low complexity region	1654	1666	N/A	INTRINSIC
low complexity region	1667	1681	N/A	INTRINSIC
low complexity region	1718	1733	N/A	INTRINSIC
low complexity region	1999	2008	N/A	INTRINSIC
low complexity region	2375	2384	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000177984

Predicted Effect

probably benign
Transcript: ENSMUST00000178076
AA Change: G1488D

PolyPhen 2 Score 0.061 (Sensitivity: 0.94; Specificity: 0.84)

SMART Domains

Protein: ENSMUSP00000136888
Gene: ENSMUSG00000021198
AA Change: G1488D

Domain	Start	End	E-Value	Type
Pfam:UNC-79	1	450	4.2e-213	PFAM
low complexity region	713	718	N/A	INTRINSIC
low complexity region	827	843	N/A	INTRINSIC
low complexity region	949	958	N/A	INTRINSIC
low complexity region	1117	1128	N/A	INTRINSIC
low complexity region	1316	1328	N/A	INTRINSIC
low complexity region	1431	1443	N/A	INTRINSIC
low complexity region	1474	1479	N/A	INTRINSIC
low complexity region	1480	1492	N/A	INTRINSIC
low complexity region	1493	1507	N/A	INTRINSIC
low complexity region	1544	1559	N/A	INTRINSIC
low complexity region	1864	1873	N/A	INTRINSIC
low complexity region	2240	2249	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000179002
AA Change: G1681D

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000136332
Gene: ENSMUSG00000021198
AA Change: G1681D

Domain	Start	End	E-Value	Type
Pfam:UNC-79	60	593	1.3e-226	PFAM
low complexity region	856	861	N/A	INTRINSIC
low complexity region	970	986	N/A	INTRINSIC
low complexity region	1092	1101	N/A	INTRINSIC
low complexity region	1260	1271	N/A	INTRINSIC
low complexity region	1509	1521	N/A	INTRINSIC
low complexity region	1624	1636	N/A	INTRINSIC
low complexity region	1667	1672	N/A	INTRINSIC
low complexity region	1673	1685	N/A	INTRINSIC
low complexity region	1686	1700	N/A	INTRINSIC
low complexity region	1737	1752	N/A	INTRINSIC
low complexity region	2057	2066	N/A	INTRINSIC
low complexity region	2433	2442	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.5%
20x: 98.4%

Validation Efficiency

100% (70/70)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The NALCN channel is responsible for Na(+) leak currents. The protein encoded by this gene, along with UNC80, is an accessory subunit of the NALCN channel that contributes to the Ca(2+) sensitivity of the channel. [provided by RefSeq, Sep 2016]
PHENOTYPE: Homozygous mutation results in lethality within the first week after birth, mostly at P0 or P1. Pups fail to nurse and have no milk in stomachs resulting in weakness, inactivity and no weight gain. [provided by MGI curators]

Allele List at MGI

All alleles(2) : Targeted, knock-out(1) Chemically induced(1)

Other mutations in this stock

Total: 69 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1810046K07Rik	C	T	9: 51,290,181	D192N	probably damaging	Het
4932415D10Rik	T	C	10: 82,293,636	N1180S	probably benign	Het
Abca16	T	C	7: 120,527,121	F1167L	probably damaging	Het
Abraxas2	G	A	7: 132,874,965	A145T	probably damaging	Het
Acaca	C	T	11: 84,292,929	T32I	probably benign	Het
Adam6a	A	T	12: 113,545,050	N348Y	possibly damaging	Het
Ankdd1a	C	T	9: 65,508,061	A227T	possibly damaging	Het
Arhgef38	T	C	3: 133,234,708	D39G	possibly damaging	Het
Arid5b	T	C	10: 68,097,582	D587G	possibly damaging	Het
Brwd1	A	G	16: 96,007,941	V1963A	probably benign	Het
Ccdc136	T	A	6: 29,410,205	L34Q	probably damaging	Het
Cdh2	T	C	18: 16,774,522	Q53R	probably benign	Het
Celsr2	G	A	3: 108,401,214	S1799L	probably damaging	Het
Cenpe	A	G	3: 135,230,175	E457G	probably benign	Het
Cmtm1	A	T	8: 104,305,163	M283K	possibly damaging	Het
Dcdc5	T	C	2: 106,368,171		noncoding transcript	Het
Decr1	T	A	4: 15,924,261	M220L	probably benign	Het
Dgkg	T	G	16: 22,519,561	D592A	probably damaging	Het
Dkkl1	T	C	7: 45,211,438	Q39R	probably benign	Het
Dyrk1a	T	A	16: 94,659,514	C10S	possibly damaging	Het
Efcab2	A	T	1: 178,481,371	E146D	probably benign	Het
Efhc1	T	C	1: 20,979,428	V504A	possibly damaging	Het
Ermard	T	G	17: 15,053,205		probably null	Het
Espl1	T	C	15: 102,315,812	V1266A	probably benign	Het
Fbxw22	A	C	9: 109,403,397	V40G	probably damaging	Het
Gm3460	A	T	14: 6,619,410	I194N	possibly damaging	Het
Gnai2	C	T	9: 107,620,097	V33M	possibly damaging	Het
H2-DMb1	T	C	17: 34,157,532		probably null	Het
Hc	T	C	2: 34,989,839		probably null	Het
Iars	T	C	13: 49,708,445	S491P	probably damaging	Het
Knl1	T	A	2: 119,069,318	L500H	probably damaging	Het
Lamb1	A	T	12: 31,269,147	T102S	probably damaging	Het
Lrrc7	A	G	3: 158,160,736	S1123P	probably damaging	Het
Mettl5	C	A	2: 69,871,727		probably null	Het
Mmp11	A	G	10: 75,923,984	*4R	probably null	Het
Myom1	A	T	17: 71,082,488	D911V	probably benign	Het
Nid1	A	G	13: 13,463,782	T96A	probably benign	Het
Nlrp4e	G	T	7: 23,353,172	V839L	probably benign	Het
Notch3	A	T	17: 32,151,154		probably null	Het
Olfr1082	T	C	2: 86,594,067	T254A	possibly damaging	Het
Pcdh8	T	C	14: 79,767,651	H978R	probably benign	Het
Pde8b	A	T	13: 95,042,000	C537*	probably null	Het
Polr1b	T	C	2: 129,125,446	F920L	probably damaging	Het
Polr2f	A	G	15: 79,151,373	T87A	probably damaging	Het
Pon2	T	A	6: 5,272,421	H133L	probably damaging	Het
Ptk2b	T	A	14: 66,178,831	E205V	probably damaging	Het
Rb1cc1	T	A	1: 6,244,133	M343K	probably benign	Het
Rlf	G	A	4: 121,148,610	R1058W	probably damaging	Het
S100z	T	A	13: 95,478,574	K28*	probably null	Het
Scarf1	T	A	11: 75,520,315	N273K	probably benign	Het
Setd2	A	G	9: 110,556,366	I136M	unknown	Het
Sfrp2	A	G	3: 83,766,984	D148G	probably benign	Het
Slc24a4	A	G	12: 102,254,510	E400G	probably benign	Het
Slc2a9	T	G	5: 38,453,121	I112L	probably benign	Het
Smc5	A	T	19: 23,208,948	Y972*	probably null	Het
Sntg1	T	C	1: 8,445,024		probably null	Het
Stag1	A	G	9: 100,757,733	D114G	probably damaging	Het
Suclg1	T	C	6: 73,256,209	S46P	probably damaging	Het
Synj1	C	T	16: 90,946,815	A1186T	probably benign	Het
Tas2r124	A	G	6: 132,755,447	T240A	probably benign	Het
Tax1bp1	T	C	6: 52,744,356		probably null	Het
Tchh	C	A	3: 93,447,851	Q1533K	unknown	Het
Tmprss15	T	C	16: 78,962,170	T887A	probably benign	Het
Ttn	T	C	2: 76,706,593	I34963V	probably benign	Het
Usp9y	G	T	Y: 1,385,355	H633N	probably benign	Homo
Vmn2r99	A	T	17: 19,382,605	N541Y	probably damaging	Het
Zbtb11	T	A	16: 55,990,491	N337K	probably benign	Het
Zfp260	T	A	7: 30,104,842	C56S	possibly damaging	Het
Zfp457	C	T	13: 67,292,682	E610K	probably damaging	Het

Other mutations in Unc79

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00718:Unc79	APN	12	103169647	missense	possibly damaging	0.68
IGL00835:Unc79	APN	12	103141890	splice site	probably benign
IGL00917:Unc79	APN	12	103088507	missense	possibly damaging	0.53
IGL01012:Unc79	APN	12	103112455	missense	probably damaging	1.00
IGL01121:Unc79	APN	12	103165631	missense	probably damaging	0.99
IGL01303:Unc79	APN	12	103161867	missense	possibly damaging	0.94
IGL01305:Unc79	APN	12	103001871	missense	probably damaging	0.99
IGL01315:Unc79	APN	12	103088521	missense	possibly damaging	0.66
IGL01388:Unc79	APN	12	103169759	splice site	probably benign
IGL01415:Unc79	APN	12	103108685	missense	probably damaging	1.00
IGL01447:Unc79	APN	12	103078918	missense	probably damaging	1.00
IGL01655:Unc79	APN	12	103168287	missense	probably benign	0.00
IGL01662:Unc79	APN	12	103149020	missense	possibly damaging	0.92
IGL01728:Unc79	APN	12	103165684	missense	probably damaging	0.98
IGL01767:Unc79	APN	12	103141997	missense	probably damaging	1.00
IGL02080:Unc79	APN	12	103001975	missense	probably damaging	1.00
IGL02115:Unc79	APN	12	102998674	missense	probably damaging	1.00
IGL02176:Unc79	APN	12	102998747	splice site	probably null
IGL02186:Unc79	APN	12	103011283	missense	probably benign	0.04
IGL02205:Unc79	APN	12	103079001	missense	probably damaging	1.00
IGL02337:Unc79	APN	12	103156446	splice site	probably benign
IGL02498:Unc79	APN	12	103171578	missense	probably damaging	0.99
IGL02508:Unc79	APN	12	103112276	missense	probably damaging	0.97
IGL02508:Unc79	APN	12	103112018	splice site	probably benign
IGL02557:Unc79	APN	12	103182159	splice site	probably benign
IGL02589:Unc79	APN	12	103173496	missense	probably damaging	1.00
IGL02611:Unc79	APN	12	103165708	missense	probably damaging	0.97
IGL02728:Unc79	APN	12	103122429	missense	possibly damaging	0.53
IGL02827:Unc79	APN	12	103074846	missense	possibly damaging	0.88
IGL03028:Unc79	APN	12	103173526	missense	possibly damaging	0.83
IGL03144:Unc79	APN	12	103042142	missense	probably damaging	1.00
IGL03229:Unc79	APN	12	103134539	missense	probably damaging	0.99
IGL03269:Unc79	APN	12	103088677	missense	probably damaging	1.00
IGL03325:Unc79	APN	12	103169610	missense	probably damaging	0.98
pencil-thin	UTSW	12	103108781	splice site	probably null
sweetpea	UTSW	12	103059518	missense	probably damaging	1.00
3-1:Unc79	UTSW	12	103072750	nonsense	probably null
ANU22:Unc79	UTSW	12	103001871	missense	probably damaging	0.99
R0046:Unc79	UTSW	12	103125681	missense	probably damaging	0.99
R0046:Unc79	UTSW	12	103125681	missense	probably damaging	0.99
R0067:Unc79	UTSW	12	103059518	missense	probably damaging	1.00
R0067:Unc79	UTSW	12	103059518	missense	probably damaging	1.00
R0107:Unc79	UTSW	12	103134525	missense	possibly damaging	0.70
R0110:Unc79	UTSW	12	103079070	critical splice donor site	probably null
R0128:Unc79	UTSW	12	103088434	splice site	probably benign
R0166:Unc79	UTSW	12	103156553	missense	probably damaging	1.00
R0208:Unc79	UTSW	12	103092027	missense	probably benign	0.00
R0211:Unc79	UTSW	12	103072792	missense	probably benign	0.01
R0211:Unc79	UTSW	12	103072792	missense	probably benign	0.01
R0218:Unc79	UTSW	12	103108781	splice site	probably null
R0244:Unc79	UTSW	12	103112891	missense	probably damaging	1.00
R0305:Unc79	UTSW	12	103113200	missense	probably benign	0.18
R0310:Unc79	UTSW	12	103061407	missense	probably damaging	1.00
R0325:Unc79	UTSW	12	103171644	missense	probably damaging	0.98
R0369:Unc79	UTSW	12	103088772	critical splice donor site	probably null
R0450:Unc79	UTSW	12	103079070	critical splice donor site	probably null
R0503:Unc79	UTSW	12	103078868	missense	probably benign	0.01
R0542:Unc79	UTSW	12	103094178	splice site	probably benign
R0845:Unc79	UTSW	12	103173444	splice site	probably benign
R0893:Unc79	UTSW	12	102991428	missense	probably damaging	1.00
R1078:Unc79	UTSW	12	103074853	missense	probably benign	0.03
R1148:Unc79	UTSW	12	103112667	missense	probably damaging	1.00
R1148:Unc79	UTSW	12	103112667	missense	probably damaging	1.00
R1159:Unc79	UTSW	12	103047052	splice site	probably benign
R1191:Unc79	UTSW	12	103047012	nonsense	probably null
R1307:Unc79	UTSW	12	103070076	missense	probably damaging	1.00
R1368:Unc79	UTSW	12	103156513	missense	probably damaging	1.00
R1476:Unc79	UTSW	12	103183525	missense	probably damaging	1.00
R1650:Unc79	UTSW	12	103112793	missense	possibly damaging	0.85
R1777:Unc79	UTSW	12	103112455	missense	probably damaging	1.00
R1796:Unc79	UTSW	12	103142746	missense	probably damaging	0.99
R1824:Unc79	UTSW	12	103059320	missense	probably damaging	1.00
R1830:Unc79	UTSW	12	103134478	missense	probably damaging	1.00
R1927:Unc79	UTSW	12	103169692	missense	probably damaging	1.00
R1958:Unc79	UTSW	12	102991362	missense	probably damaging	1.00
R1958:Unc79	UTSW	12	103074919	missense	probably benign	0.19
R1980:Unc79	UTSW	12	103011279	nonsense	probably null
R2019:Unc79	UTSW	12	103171571	critical splice acceptor site	probably null
R2290:Unc79	UTSW	12	103146366	missense	probably damaging	1.00
R2939:Unc79	UTSW	12	102991425	missense	probably damaging	1.00
R2962:Unc79	UTSW	12	103095119	missense	possibly damaging	0.72
R3176:Unc79	UTSW	12	103113217	missense	probably damaging	1.00
R3276:Unc79	UTSW	12	103113217	missense	probably damaging	1.00
R3683:Unc79	UTSW	12	103074803	missense	probably benign	0.00
R3684:Unc79	UTSW	12	103074803	missense	probably benign	0.00
R3686:Unc79	UTSW	12	103088661	missense	probably damaging	1.00
R3760:Unc79	UTSW	12	103092705	missense	probably damaging	1.00
R4031:Unc79	UTSW	12	103072759	missense	possibly damaging	0.46
R4039:Unc79	UTSW	12	103074949	missense	possibly damaging	0.88
R4110:Unc79	UTSW	12	103059370	missense	probably damaging	1.00
R4113:Unc79	UTSW	12	103059370	missense	probably damaging	1.00
R4159:Unc79	UTSW	12	103070253	intron	probably benign
R4273:Unc79	UTSW	12	103122353	missense	probably damaging	0.99
R4292:Unc79	UTSW	12	103183444	missense	probably damaging	0.99
R4334:Unc79	UTSW	12	103078974	missense	probably benign
R4513:Unc79	UTSW	12	103021760	missense	probably damaging	1.00
R4562:Unc79	UTSW	12	102991461	missense	probably damaging	1.00
R4576:Unc79	UTSW	12	103001803	splice site	probably benign
R4645:Unc79	UTSW	12	103112822	missense	probably benign
R4758:Unc79	UTSW	12	103161821	nonsense	probably null
R4787:Unc79	UTSW	12	103046998	missense	probably damaging	1.00
R4852:Unc79	UTSW	12	103173466	missense	probably damaging	0.98
R4883:Unc79	UTSW	12	103094333	missense	probably damaging	0.99
R4898:Unc79	UTSW	12	103161820	missense	probably damaging	0.99
R4979:Unc79	UTSW	12	103112432	missense	probably benign
R5044:Unc79	UTSW	12	103112703	missense	probably benign	0.32
R5053:Unc79	UTSW	12	103104748	missense	probably damaging	1.00
R5061:Unc79	UTSW	12	103168441	missense	possibly damaging	0.94
R5075:Unc79	UTSW	12	103074954	missense	possibly damaging	0.63
R5101:Unc79	UTSW	12	103112510	missense	probably damaging	1.00
R5236:Unc79	UTSW	12	103094395	critical splice donor site	probably null
R5240:Unc79	UTSW	12	103070751	missense	probably damaging	0.99
R5383:Unc79	UTSW	12	103104627	missense	possibly damaging	0.53
R5461:Unc79	UTSW	12	103112138	missense	probably damaging	1.00
R5535:Unc79	UTSW	12	103169703	missense	possibly damaging	0.84
R5609:Unc79	UTSW	12	103128268	missense	probably benign
R5639:Unc79	UTSW	12	103171572	missense	probably damaging	1.00
R5704:Unc79	UTSW	12	103001943	missense	probably damaging	1.00
R5923:Unc79	UTSW	12	103112468	missense	probably damaging	1.00
R5925:Unc79	UTSW	12	103125730	splice site	probably null
R5975:Unc79	UTSW	12	103125626	missense	possibly damaging	0.53
R6047:Unc79	UTSW	12	103061458	missense	probably damaging	1.00
R6156:Unc79	UTSW	12	103061458	missense	probably damaging	1.00
R6175:Unc79	UTSW	12	103183449	missense	probably damaging	0.98
R6292:Unc79	UTSW	12	103142732	missense	possibly damaging	0.88
R6391:Unc79	UTSW	12	103021010	missense	probably damaging	1.00
R6405:Unc79	UTSW	12	103168336	missense	probably damaging	0.97
R6416:Unc79	UTSW	12	103131646	missense	possibly damaging	0.86
R6467:Unc79	UTSW	12	103173512	missense	probably damaging	1.00
R6573:Unc79	UTSW	12	103061388	missense	probably damaging	1.00
R6614:Unc79	UTSW	12	102991430	missense	probably damaging	1.00
R6654:Unc79	UTSW	12	103079048	missense	probably damaging	0.99
R6654:Unc79	UTSW	12	103079049	missense	probably damaging	1.00
R6700:Unc79	UTSW	12	103125703	missense	possibly damaging	0.92
R6724:Unc79	UTSW	12	103104861	missense	probably damaging	1.00
R6819:Unc79	UTSW	12	103142008	missense	probably benign	0.12
R6869:Unc79	UTSW	12	103113072	missense	probably benign	0.33
R6879:Unc79	UTSW	12	103148787	splice site	probably null
R6942:Unc79	UTSW	12	103122445	critical splice donor site	probably null
R6961:Unc79	UTSW	12	103112915	missense	probably damaging	1.00
R6973:Unc79	UTSW	12	102998440	missense	possibly damaging	0.86
R6980:Unc79	UTSW	12	103059500	missense	probably damaging	1.00
R7124:Unc79	UTSW	12	103061393	missense	probably damaging	0.99
R7144:Unc79	UTSW	12	103142626	missense	probably benign	0.06
R7197:Unc79	UTSW	12	103112506	missense	probably benign
R7209:Unc79	UTSW	12	103125624	missense	probably benign
R7232:Unc79	UTSW	12	103134475	missense	possibly damaging	0.49
R7304:Unc79	UTSW	12	103063190	missense	probably damaging	1.00
R7354:Unc79	UTSW	12	103142702	missense	possibly damaging	0.79
R7384:Unc79	UTSW	12	103171578	missense	probably benign	0.11
R7400:Unc79	UTSW	12	103104630	missense	probably damaging	1.00
R7417:Unc79	UTSW	12	103088758	missense	possibly damaging	0.85
R7470:Unc79	UTSW	12	103094976	missense	probably damaging	1.00
R7842:Unc79	UTSW	12	103092054	missense	probably damaging	1.00
R8037:Unc79	UTSW	12	103049919	missense	probably damaging	1.00
R8041:Unc79	UTSW	12	103088467	missense	probably benign	0.06
R8146:Unc79	UTSW	12	103070157	missense	probably damaging	0.98
R8276:Unc79	UTSW	12	103001863	missense	possibly damaging	0.94
R8427:Unc79	UTSW	12	103079038	missense	probably benign	0.24
R8501:Unc79	UTSW	12	103092638	missense	probably damaging	1.00
R8510:Unc79	UTSW	12	103104639	missense	probably damaging	1.00
R8531:Unc79	UTSW	12	103047663	missense	probably damaging	1.00
R8531:Unc79	UTSW	12	103083596	missense	probably benign	0.13
R8795:Unc79	UTSW	12	103108254	missense	probably damaging	1.00
R9017:Unc79	UTSW	12	103108615	critical splice acceptor site	probably null
R9121:Unc79	UTSW	12	103001836	missense	probably damaging	1.00
R9196:Unc79	UTSW	12	103112354	missense	probably benign
R9443:Unc79	UTSW	12	103070776	missense	probably damaging	1.00
R9548:Unc79	UTSW	12	103011236	missense	probably damaging	1.00
R9600:Unc79	UTSW	12	103169713	missense	probably benign	0.07
R9767:Unc79	UTSW	12	103112975	missense	probably benign
R9787:Unc79	UTSW	12	103146361	missense	probably benign	0.00
RF010:Unc79	UTSW	12	103112787	missense	probably benign	0.17
X0017:Unc79	UTSW	12	103108261	missense	probably damaging	0.99
X0028:Unc79	UTSW	12	102991403	missense	probably damaging	1.00
Z1088:Unc79	UTSW	12	103021012	missense	probably damaging	1.00
Z1176:Unc79	UTSW	12	103088678	missense	probably damaging	1.00
Z1176:Unc79	UTSW	12	103142053	missense	probably benign	0.03
Z1177:Unc79	UTSW	12	103165689	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- TTGATTCCCCAGGAAAGCC -3'
(R):5'- ACAGCTCTTCAGAGTCCGTG -3'

Sequencing Primer
(F):5'- AGGAAAGCCTGCTCCTAGG -3'
(R):5'- CTCTTCAGAGTCCGTGAGGTC -3'

Posted On

2018-04-02