Mutagenetix > Incidental Mutation

Incidental Mutation 'R6313:Nid1'

510540

Institutional Source

Beutler Lab

Gene Symbol

Nid1

Ensembl Gene

ENSMUSG00000005397

Gene Name

nidogen 1

Synonyms

entactin 1, nidogen-1, entactin, entactin-1

MMRRC Submission

044470-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.202) question?

Stock #

R6313 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

13437551-13512269 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 13463782 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Alanine at position 96 (T96A)

Ref Sequence

ENSEMBL: ENSMUSP00000005532 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000005532]

AlphaFold

P10493

PDB Structure

NIDOGEN-1 G2/PERLECAN IG3 COMPLEX [X-RAY DIFFRACTION]
DOMAIN G2 OF MOUSE NIDOGEN-1 [X-RAY DIFFRACTION]
Crystal structure of Nidogen/Laminin Complex [X-RAY DIFFRACTION]

Predicted Effect

probably benign
Transcript: ENSMUST00000005532
AA Change: T96A

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)

SMART Domains

Protein: ENSMUSP00000005532
Gene: ENSMUSG00000005397
AA Change: T96A

Domain	Start	End	E-Value	Type
signal peptide	1	28	N/A	INTRINSIC
NIDO	106	270	3.8e-70	SMART
low complexity region	277	296	N/A	INTRINSIC
EGF	387	424	3.46e0	SMART
G2F	425	664	7.69e-153	SMART
EGF	669	707	8.65e-1	SMART
EGF_CA	708	749	4.38e-11	SMART
EGF	759	799	8.19e-2	SMART
EGF_CA	800	838	1.42e-10	SMART
TY	873	921	1.17e-19	SMART
LY	968	1010	1.35e-2	SMART
LY	1011	1053	4.34e-15	SMART
LY	1054	1098	3.34e-16	SMART
LY	1099	1141	3.25e-5	SMART
LY	1142	1181	1.08e1	SMART
EGF	1209	1242	2.45e0	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000222142

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.5%
20x: 98.4%

Validation Efficiency

100% (70/70)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the nidogen family of basement membrane glycoproteins. The protein interacts with several other components of basement membranes, and may play a role in cell interactions with the extracellular matrix. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit neurologic deficits including seizure-like symptoms and loss of muscle control in the hind legs, and show altered basement membrane morphology in selected locations including brain capillaries and the lens capsule. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 69 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1810046K07Rik	C	T	9: 51,290,181	D192N	probably damaging	Het
4932415D10Rik	T	C	10: 82,293,636	N1180S	probably benign	Het
Abca16	T	C	7: 120,527,121	F1167L	probably damaging	Het
Abraxas2	G	A	7: 132,874,965	A145T	probably damaging	Het
Acaca	C	T	11: 84,292,929	T32I	probably benign	Het
Adam6a	A	T	12: 113,545,050	N348Y	possibly damaging	Het
Ankdd1a	C	T	9: 65,508,061	A227T	possibly damaging	Het
Arhgef38	T	C	3: 133,234,708	D39G	possibly damaging	Het
Arid5b	T	C	10: 68,097,582	D587G	possibly damaging	Het
Brwd1	A	G	16: 96,007,941	V1963A	probably benign	Het
Ccdc136	T	A	6: 29,410,205	L34Q	probably damaging	Het
Cdh2	T	C	18: 16,774,522	Q53R	probably benign	Het
Celsr2	G	A	3: 108,401,214	S1799L	probably damaging	Het
Cenpe	A	G	3: 135,230,175	E457G	probably benign	Het
Cmtm1	A	T	8: 104,305,163	M283K	possibly damaging	Het
Dcdc5	T	C	2: 106,368,171		noncoding transcript	Het
Decr1	T	A	4: 15,924,261	M220L	probably benign	Het
Dgkg	T	G	16: 22,519,561	D592A	probably damaging	Het
Dkkl1	T	C	7: 45,211,438	Q39R	probably benign	Het
Dyrk1a	T	A	16: 94,659,514	C10S	possibly damaging	Het
Efcab2	A	T	1: 178,481,371	E146D	probably benign	Het
Efhc1	T	C	1: 20,979,428	V504A	possibly damaging	Het
Ermard	T	G	17: 15,053,205		probably null	Het
Espl1	T	C	15: 102,315,812	V1266A	probably benign	Het
Fbxw22	A	C	9: 109,403,397	V40G	probably damaging	Het
Gm3460	A	T	14: 6,619,410	I194N	possibly damaging	Het
Gnai2	C	T	9: 107,620,097	V33M	possibly damaging	Het
H2-DMb1	T	C	17: 34,157,532		probably null	Het
Hc	T	C	2: 34,989,839		probably null	Het
Iars	T	C	13: 49,708,445	S491P	probably damaging	Het
Knl1	T	A	2: 119,069,318	L500H	probably damaging	Het
Lamb1	A	T	12: 31,269,147	T102S	probably damaging	Het
Lrrc7	A	G	3: 158,160,736	S1123P	probably damaging	Het
Mettl5	C	A	2: 69,871,727		probably null	Het
Mmp11	A	G	10: 75,923,984	*4R	probably null	Het
Myom1	A	T	17: 71,082,488	D911V	probably benign	Het
Nlrp4e	G	T	7: 23,353,172	V839L	probably benign	Het
Notch3	A	T	17: 32,151,154		probably null	Het
Olfr1082	T	C	2: 86,594,067	T254A	possibly damaging	Het
Pcdh8	T	C	14: 79,767,651	H978R	probably benign	Het
Pde8b	A	T	13: 95,042,000	C537*	probably null	Het
Polr1b	T	C	2: 129,125,446	F920L	probably damaging	Het
Polr2f	A	G	15: 79,151,373	T87A	probably damaging	Het
Pon2	T	A	6: 5,272,421	H133L	probably damaging	Het
Ptk2b	T	A	14: 66,178,831	E205V	probably damaging	Het
Rb1cc1	T	A	1: 6,244,133	M343K	probably benign	Het
Rlf	G	A	4: 121,148,610	R1058W	probably damaging	Het
S100z	T	A	13: 95,478,574	K28*	probably null	Het
Scarf1	T	A	11: 75,520,315	N273K	probably benign	Het
Setd2	A	G	9: 110,556,366	I136M	unknown	Het
Sfrp2	A	G	3: 83,766,984	D148G	probably benign	Het
Slc24a4	A	G	12: 102,254,510	E400G	probably benign	Het
Slc2a9	T	G	5: 38,453,121	I112L	probably benign	Het
Smc5	A	T	19: 23,208,948	Y972*	probably null	Het
Sntg1	T	C	1: 8,445,024		probably null	Het
Stag1	A	G	9: 100,757,733	D114G	probably damaging	Het
Suclg1	T	C	6: 73,256,209	S46P	probably damaging	Het
Synj1	C	T	16: 90,946,815	A1186T	probably benign	Het
Tas2r124	A	G	6: 132,755,447	T240A	probably benign	Het
Tax1bp1	T	C	6: 52,744,356		probably null	Het
Tchh	C	A	3: 93,447,851	Q1533K	unknown	Het
Tmprss15	T	C	16: 78,962,170	T887A	probably benign	Het
Ttn	T	C	2: 76,706,593	I34963V	probably benign	Het
Unc79	G	A	12: 103,112,619	G1485D	probably damaging	Het
Usp9y	G	T	Y: 1,385,355	H633N	probably benign	Homo
Vmn2r99	A	T	17: 19,382,605	N541Y	probably damaging	Het
Zbtb11	T	A	16: 55,990,491	N337K	probably benign	Het
Zfp260	T	A	7: 30,104,842	C56S	possibly damaging	Het
Zfp457	C	T	13: 67,292,682	E610K	probably damaging	Het

Other mutations in Nid1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00092:Nid1	APN	13	13476392	missense	probably damaging	1.00
IGL02126:Nid1	APN	13	13489158	splice site	probably null
IGL02452:Nid1	APN	13	13508720	missense	probably benign	0.17
IGL02806:Nid1	APN	13	13468312	missense	probably benign	0.00
IGL02966:Nid1	APN	13	13482221	missense	probably benign	0.09
IGL03136:Nid1	APN	13	13500499	missense	probably benign	0.33
IGL03411:Nid1	APN	13	13437889	missense	probably damaging	0.98
R0384:Nid1	UTSW	13	13463836	missense	probably benign	0.34
R0413:Nid1	UTSW	13	13482096	missense	probably benign	0.01
R1257:Nid1	UTSW	13	13483790	missense	probably benign	0.01
R1390:Nid1	UTSW	13	13476246	missense	probably damaging	1.00
R1397:Nid1	UTSW	13	13508795	missense	possibly damaging	0.94
R2057:Nid1	UTSW	13	13500473	missense	probably benign	0.00
R2058:Nid1	UTSW	13	13500473	missense	probably benign	0.00
R2059:Nid1	UTSW	13	13500473	missense	probably benign	0.00
R2132:Nid1	UTSW	13	13509486	missense	probably benign	0.04
R2140:Nid1	UTSW	13	13499668	missense	probably damaging	1.00
R2195:Nid1	UTSW	13	13476203	missense	probably damaging	1.00
R2237:Nid1	UTSW	13	13500485	missense	probably benign
R2312:Nid1	UTSW	13	13500493	missense	probably benign	0.15
R2987:Nid1	UTSW	13	13499673	missense	probably benign	0.40
R3696:Nid1	UTSW	13	13486759	missense	probably damaging	0.99
R3697:Nid1	UTSW	13	13486759	missense	probably damaging	0.99
R3698:Nid1	UTSW	13	13486759	missense	probably damaging	0.99
R3772:Nid1	UTSW	13	13476418	splice site	probably benign
R4092:Nid1	UTSW	13	13486639	missense	probably damaging	0.96
R4126:Nid1	UTSW	13	13476372	missense	probably damaging	1.00
R4128:Nid1	UTSW	13	13476372	missense	probably damaging	1.00
R4680:Nid1	UTSW	13	13472852	missense	probably damaging	1.00
R4717:Nid1	UTSW	13	13506501	missense	probably benign	0.00
R4783:Nid1	UTSW	13	13499741	missense	probably damaging	0.97
R4812:Nid1	UTSW	13	13506468	nonsense	probably null
R4834:Nid1	UTSW	13	13508823	missense	probably damaging	1.00
R4915:Nid1	UTSW	13	13499586	missense	possibly damaging	0.89
R4930:Nid1	UTSW	13	13510011	missense	probably damaging	1.00
R5101:Nid1	UTSW	13	13483754	missense	probably damaging	1.00
R5276:Nid1	UTSW	13	13468572	missense	probably damaging	0.99
R5427:Nid1	UTSW	13	13483683	missense	probably damaging	1.00
R5447:Nid1	UTSW	13	13437910	missense	probably benign	0.00
R5507:Nid1	UTSW	13	13489037	nonsense	probably null
R5663:Nid1	UTSW	13	13472834	missense	probably damaging	1.00
R5868:Nid1	UTSW	13	13489157	critical splice donor site	probably null
R6761:Nid1	UTSW	13	13482035	missense	probably benign	0.22
R7069:Nid1	UTSW	13	13508768	missense	probably benign
R7208:Nid1	UTSW	13	13468385	missense	probably benign	0.01
R7284:Nid1	UTSW	13	13489090	missense	probably benign	0.01
R7434:Nid1	UTSW	13	13468464	missense	probably benign
R7449:Nid1	UTSW	13	13482051	missense	probably damaging	1.00
R7574:Nid1	UTSW	13	13468443	missense	probably benign
R7762:Nid1	UTSW	13	13489045	missense	probably damaging	1.00
R7887:Nid1	UTSW	13	13499733	missense	possibly damaging	0.83
R8420:Nid1	UTSW	13	13437831	missense	possibly damaging	0.81
R8506:Nid1	UTSW	13	13476174	missense	probably damaging	0.99
R8756:Nid1	UTSW	13	13508801	missense	probably benign	0.32
R8903:Nid1	UTSW	13	13463930	missense	probably benign	0.00
R9084:Nid1	UTSW	13	13478340	critical splice donor site	probably null
R9297:Nid1	UTSW	13	13476312	missense	possibly damaging	0.92
R9344:Nid1	UTSW	13	13478309	missense	probably damaging	1.00
R9552:Nid1	UTSW	13	13502460	missense	probably damaging	0.99
X0028:Nid1	UTSW	13	13509534	missense	probably benign	0.14

Predicted Primers

PCR Primer
(F):5'- GAGGGAGAGATCACTTGCTG -3'
(R):5'- GCCACAGATTCCCAAGTGAC -3'

Sequencing Primer
(F):5'- ACAGTCTGTGTGATGAGACCC -3'
(R):5'- GTGACAACCACCACACTAGTG -3'

Posted On

2018-04-02