Incidental Mutation 'R6313:Dyrk1a'
ID510554
Institutional Source Beutler Lab
Gene Symbol Dyrk1a
Ensembl Gene ENSMUSG00000022897
Gene Namedual-specificity tyrosine-(Y)-phosphorylation regulated kinase 1a
SynonymsD16Ertd493e, Mnbh, 2310043O08Rik, D16Ertd272e, Dyrk
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6313 (G1)
Quality Score225.009
Status Validated
Chromosome16
Chromosomal Location94570010-94695517 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 94659514 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Serine at position 10 (C10S)
Ref Sequence ENSEMBL: ENSMUSP00000119669 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023614] [ENSMUST00000119878] [ENSMUST00000122284] [ENSMUST00000139250] [ENSMUST00000155791]
Predicted Effect possibly damaging
Transcript: ENSMUST00000023614
AA Change: C10S

PolyPhen 2 Score 0.948 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000023614
Gene: ENSMUSG00000022897
AA Change: C10S

DomainStartEndE-ValueType
low complexity region 136 147 N/A INTRINSIC
S_TKc 159 479 6.63e-79 SMART
low complexity region 502 525 N/A INTRINSIC
low complexity region 599 620 N/A INTRINSIC
low complexity region 650 672 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000119878
AA Change: C10S

PolyPhen 2 Score 0.948 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000113660
Gene: ENSMUSG00000022897
AA Change: C10S

DomainStartEndE-ValueType
low complexity region 136 147 N/A INTRINSIC
S_TKc 159 479 6.63e-79 SMART
low complexity region 502 525 N/A INTRINSIC
low complexity region 599 620 N/A INTRINSIC
low complexity region 650 672 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000122284
SMART Domains Protein: ENSMUSP00000112853
Gene: ENSMUSG00000022897

DomainStartEndE-ValueType
low complexity region 127 138 N/A INTRINSIC
S_TKc 150 470 6.63e-79 SMART
low complexity region 493 516 N/A INTRINSIC
low complexity region 590 611 N/A INTRINSIC
low complexity region 641 663 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000139250
AA Change: C10S

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
Predicted Effect probably damaging
Transcript: ENSMUST00000155791
AA Change: C10S

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000119669
Gene: ENSMUSG00000022897
AA Change: C10S

DomainStartEndE-ValueType
PDB:3ANR|D 126 181 6e-21 PDB
SCOP:d1howa_ 147 179 4e-7 SMART
Blast:S_TKc 159 181 5e-6 BLAST
Meta Mutation Damage Score 0.3338 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.4%
Validation Efficiency 100% (70/70)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Dual-specificity tyrosine phosphorylation-regulated kinase (DYRK) family. This member contains a nuclear targeting signal sequence, a protein kinase domain, a leucine zipper motif, and a highly conservative 13-consecutive-histidine repeat. It catalyzes its autophosphorylation on serine/threonine and tyrosine residues. It may play a significant role in a signaling pathway regulating cell proliferation and may be involved in brain development. This gene is a homolog of Drosophila mnb (minibrain) gene and rat Dyrk gene. It is localized in the Down syndrome critical region of chromosome 21, and is considered to be a strong candidate gene for learning defects associated with Down syndrome. Alternative splicing of this gene generates several transcript variants differing from each other either in the 5' UTR or in the 3' coding region. These variants encode at least five different isoforms. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a targeted deletion present a general embryonic growth delay and die during midgestation. Heterozygotes display reduced postnatal survival, postnatal growth retardation, microcephaly, behavioral and motor deficits, and altered neocortical pyramidal cell morphology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810046K07Rik C T 9: 51,290,181 D192N probably damaging Het
4932415D10Rik T C 10: 82,293,636 N1180S probably benign Het
Abca16 T C 7: 120,527,121 F1167L probably damaging Het
Abraxas2 G A 7: 132,874,965 A145T probably damaging Het
Acaca C T 11: 84,292,929 T32I probably benign Het
Adam6a A T 12: 113,545,050 N348Y possibly damaging Het
Ankdd1a C T 9: 65,508,061 A227T possibly damaging Het
Arhgef38 T C 3: 133,234,708 D39G possibly damaging Het
Arid5b T C 10: 68,097,582 D587G possibly damaging Het
Brwd1 A G 16: 96,007,941 V1963A probably benign Het
Ccdc136 T A 6: 29,410,205 L34Q probably damaging Het
Cdh2 T C 18: 16,774,522 Q53R probably benign Het
Celsr2 G A 3: 108,401,214 S1799L probably damaging Het
Cenpe A G 3: 135,230,175 E457G probably benign Het
Cmtm1 A T 8: 104,305,163 M283K possibly damaging Het
Dcdc5 T C 2: 106,368,171 noncoding transcript Het
Decr1 T A 4: 15,924,261 M220L probably benign Het
Dgkg T G 16: 22,519,561 D592A probably damaging Het
Dkkl1 T C 7: 45,211,438 Q39R probably benign Het
Efcab2 A T 1: 178,481,371 E146D probably benign Het
Efhc1 T C 1: 20,979,428 V504A possibly damaging Het
Ermard T G 17: 15,053,205 probably null Het
Espl1 T C 15: 102,315,812 V1266A probably benign Het
Fbxw22 A C 9: 109,403,397 V40G probably damaging Het
Gm3460 A T 14: 6,619,410 I194N possibly damaging Het
Gnai2 C T 9: 107,620,097 V33M possibly damaging Het
H2-DMb1 T C 17: 34,157,532 probably null Het
Hc T C 2: 34,989,839 probably null Het
Iars T C 13: 49,708,445 S491P probably damaging Het
Knl1 T A 2: 119,069,318 L500H probably damaging Het
Lamb1 A T 12: 31,269,147 T102S probably damaging Het
Lrrc7 A G 3: 158,160,736 S1123P probably damaging Het
Mettl5 C A 2: 69,871,727 probably null Het
Mmp11 A G 10: 75,923,984 *4R probably null Het
Myom1 A T 17: 71,082,488 D911V probably benign Het
Nid1 A G 13: 13,463,782 T96A probably benign Het
Nlrp4e G T 7: 23,353,172 V839L probably benign Het
Notch3 A T 17: 32,151,154 probably null Het
Olfr1082 T C 2: 86,594,067 T254A possibly damaging Het
Pcdh8 T C 14: 79,767,651 H978R probably benign Het
Pde8b A T 13: 95,042,000 C537* probably null Het
Polr1b T C 2: 129,125,446 F920L probably damaging Het
Polr2f A G 15: 79,151,373 T87A probably damaging Het
Pon2 T A 6: 5,272,421 H133L probably damaging Het
Ptk2b T A 14: 66,178,831 E205V probably damaging Het
Rb1cc1 T A 1: 6,244,133 M343K probably benign Het
Rlf G A 4: 121,148,610 R1058W probably damaging Het
S100z T A 13: 95,478,574 K28* probably null Het
Scarf1 T A 11: 75,520,315 N273K probably benign Het
Setd2 A G 9: 110,556,366 I136M unknown Het
Sfrp2 A G 3: 83,766,984 D148G probably benign Het
Slc24a4 A G 12: 102,254,510 E400G probably benign Het
Slc2a9 T G 5: 38,453,121 I112L probably benign Het
Smc5 A T 19: 23,208,948 Y972* probably null Het
Sntg1 T C 1: 8,445,024 probably null Het
Stag1 A G 9: 100,757,733 D114G probably damaging Het
Suclg1 T C 6: 73,256,209 S46P probably damaging Het
Synj1 C T 16: 90,946,815 A1186T probably benign Het
Tas2r124 A G 6: 132,755,447 T240A probably benign Het
Tax1bp1 T C 6: 52,744,356 probably null Het
Tchh C A 3: 93,447,851 Q1533K unknown Het
Tmprss15 T C 16: 78,962,170 T887A probably benign Het
Ttn T C 2: 76,706,593 I34963V probably benign Het
Unc79 G A 12: 103,112,619 G1485D probably damaging Het
Usp9y G T Y: 1,385,355 H633N probably benign Homo
Vmn2r99 A T 17: 19,382,605 N541Y probably damaging Het
Zbtb11 T A 16: 55,990,491 N337K probably benign Het
Zfp260 T A 7: 30,104,842 C56S possibly damaging Het
Zfp457 C T 13: 67,292,682 E610K probably damaging Het
Other mutations in Dyrk1a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01443:Dyrk1a APN 16 94685084 missense probably benign 0.21
IGL01599:Dyrk1a APN 16 94691884 missense possibly damaging 0.94
IGL01809:Dyrk1a APN 16 94659617 missense probably benign 0.00
IGL02201:Dyrk1a APN 16 94692149 missense probably benign 0.05
IGL02345:Dyrk1a APN 16 94671362 missense possibly damaging 0.88
IGL02508:Dyrk1a APN 16 94685183 missense probably damaging 0.97
IGL02709:Dyrk1a APN 16 94685243 missense probably benign 0.08
IGL02713:Dyrk1a APN 16 94685345 splice site probably benign
R0414:Dyrk1a UTSW 16 94663842 missense probably damaging 1.00
R2107:Dyrk1a UTSW 16 94686527 missense probably damaging 1.00
R2394:Dyrk1a UTSW 16 94685132 missense probably benign 0.02
R3124:Dyrk1a UTSW 16 94668801 splice site probably benign
R3125:Dyrk1a UTSW 16 94668801 splice site probably benign
R3792:Dyrk1a UTSW 16 94685074 missense probably benign 0.31
R3963:Dyrk1a UTSW 16 94663746 missense probably benign 0.00
R4573:Dyrk1a UTSW 16 94692023 missense possibly damaging 0.90
R4652:Dyrk1a UTSW 16 94692065 missense probably benign 0.02
R4965:Dyrk1a UTSW 16 94691995 nonsense probably null
R5326:Dyrk1a UTSW 16 94686581 missense probably damaging 0.98
R5540:Dyrk1a UTSW 16 94685343 critical splice donor site probably null
R5593:Dyrk1a UTSW 16 94659583 missense possibly damaging 0.64
R6396:Dyrk1a UTSW 16 94671440 missense probably damaging 1.00
R6524:Dyrk1a UTSW 16 94685120 missense probably benign 0.02
R7036:Dyrk1a UTSW 16 94686568 missense probably benign 0.09
R7326:Dyrk1a UTSW 16 94692043 missense probably damaging 0.97
R7861:Dyrk1a UTSW 16 94691716 nonsense probably null
R8310:Dyrk1a UTSW 16 94691791 missense probably benign 0.02
RF010:Dyrk1a UTSW 16 94677563 missense probably benign
Z1176:Dyrk1a UTSW 16 94691762 missense probably benign 0.06
Z1177:Dyrk1a UTSW 16 94691580 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- CAAGGCTCTTCCCAAGAATTCATAC -3'
(R):5'- AGAGGTTGCTGAATCTGGTCAG -3'

Sequencing Primer
(F):5'- TGACTCAGTGGTGCCAAATC -3'
(R):5'- TCTGGTCAGAATATGGTAAGGC -3'
Posted On2018-04-02