Incidental Mutation 'R6315:Eif5b'
ID510564
Institutional Source Beutler Lab
Gene Symbol Eif5b
Ensembl Gene ENSMUSG00000026083
Gene Nameeukaryotic translation initiation factor 5B
SynonymsA030003E17Rik, IF2
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6315 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location37998010-38055579 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 38018033 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 57 (D57G)
Ref Sequence ENSEMBL: ENSMUSP00000027252 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027252]
Predicted Effect unknown
Transcript: ENSMUST00000027252
AA Change: D57G
SMART Domains Protein: ENSMUSP00000027252
Gene: ENSMUSG00000026083
AA Change: D57G

DomainStartEndE-ValueType
low complexity region 19 32 N/A INTRINSIC
low complexity region 33 51 N/A INTRINSIC
low complexity region 94 106 N/A INTRINSIC
low complexity region 110 126 N/A INTRINSIC
low complexity region 145 161 N/A INTRINSIC
low complexity region 183 193 N/A INTRINSIC
coiled coil region 227 272 N/A INTRINSIC
coiled coil region 301 414 N/A INTRINSIC
low complexity region 480 498 N/A INTRINSIC
coiled coil region 523 554 N/A INTRINSIC
low complexity region 580 594 N/A INTRINSIC
Pfam:GTP_EFTU 625 840 4.7e-35 PFAM
Pfam:MMR_HSR1 629 753 5.1e-6 PFAM
Pfam:GTP_EFTU_D2 866 944 7.1e-11 PFAM
Pfam:IF-2 959 1066 1.4e-20 PFAM
Blast:S1 1116 1172 2e-6 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000192548
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 97% (64/66)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Accurate initiation of translation in eukaryotes is complex and requires many factors, some of which are composed of multiple subunits. The process is simpler in prokaryotes which have only three initiation factors (IF1, IF2, IF3). Two of these factors are conserved in eukaryotes: the homolog of IF1 is eIF1A and the homolog of IF2 is eIF5B. This gene encodes eIF5B. Factors eIF1A and eIF5B interact on the ribosome along with other initiation factors and GTP to position the initiation methionine tRNA on the start codon of the mRNA so that translation initiates accurately. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca15 T C 7: 120,346,092 Y464H probably damaging Het
Ahnak T C 19: 9,006,626 M1758T probably damaging Het
Ak9 A T 10: 41,406,841 D1201V possibly damaging Het
Amdhd2 A C 17: 24,158,356 H203Q probably benign Het
Ano3 A G 2: 110,697,039 M608T probably damaging Het
Arhgef4 G A 1: 34,723,477 A605T unknown Het
Atp1a2 C G 1: 172,289,336 R238P probably damaging Het
Atp8b1 C A 18: 64,531,479 R1206L probably damaging Het
B4galt5 A T 2: 167,305,809 N215K probably damaging Het
Bpifa1 A G 2: 154,146,076 K180E possibly damaging Het
Cadm1 C T 9: 47,810,119 T269M probably damaging Het
Cadm3 T C 1: 173,344,352 D252G probably benign Het
Ccdc18 A G 5: 108,161,582 R348G probably benign Het
Cers4 G A 8: 4,516,980 C94Y probably benign Het
Cfap58 G A 19: 47,941,277 R59H probably benign Het
Col19a1 C T 1: 24,526,452 G266D unknown Het
Col6a5 G T 9: 105,881,970 F2012L probably damaging Het
Dnah6 T C 6: 73,191,605 Q445R probably benign Het
Dsg3 A G 18: 20,524,586 S238G probably benign Het
E130308A19Rik G A 4: 59,691,132 S322N probably benign Het
Fbn2 T C 18: 58,054,953 probably null Het
Fbxo38 A T 18: 62,536,147 C77* probably null Het
Fgb T A 3: 83,045,055 Q169L probably benign Het
Fut9 A T 4: 25,619,774 Y347N probably damaging Het
Gabrg2 T C 11: 41,971,861 K132R probably damaging Het
Gpn3 C T 5: 122,372,575 probably benign Het
Helz2 A G 2: 181,233,202 L1833P probably damaging Het
Hk3 C T 13: 55,011,157 D484N probably benign Het
Icam4 T C 9: 21,029,952 V129A probably damaging Het
Impdh2 T C 9: 108,563,439 S280P possibly damaging Het
Impg1 C A 9: 80,394,074 G267V probably benign Het
Iqgap1 C T 7: 80,799,890 V39M possibly damaging Het
Lyst A G 13: 13,643,504 N1253S probably benign Het
Mgat4b T A 11: 50,231,764 V195E probably damaging Het
Mrgprb8 C T 7: 48,389,235 T218I probably damaging Het
Myrfl T G 10: 116,822,819 E411A possibly damaging Het
Myt1l T C 12: 29,827,798 S483P unknown Het
Neil2 A G 14: 63,183,471 V80A possibly damaging Het
Nfe2l2 G T 2: 75,676,819 D312E probably damaging Het
Nin A T 12: 70,045,615 L640Q probably damaging Het
Nup205 T A 6: 35,236,869 I1732N probably damaging Het
Nupl2 T C 5: 24,167,504 S97P probably damaging Het
Olfr1468-ps1 T C 19: 13,375,405 C148R unknown Het
Olfr180 A C 16: 58,916,246 Y132D probably damaging Het
Plcb1 A T 2: 135,346,341 T785S probably benign Het
Plch1 C T 3: 63,781,390 W131* probably null Het
Ppp1r1b A G 11: 98,355,390 E66G probably damaging Het
Ros1 A T 10: 52,118,210 W1325R probably benign Het
Sec14l5 A C 16: 5,180,277 E500A possibly damaging Het
Sirpb1c A G 3: 15,832,306 V302A possibly damaging Het
Spata19 T C 9: 27,400,837 Y107H possibly damaging Het
Sv2a G A 3: 96,188,186 M298I probably benign Het
Tdrd6 A T 17: 43,626,338 M1273K probably benign Het
Tectb A G 19: 55,191,472 H250R possibly damaging Het
Trip11 T G 12: 101,885,578 E742D possibly damaging Het
Tslp A G 18: 32,817,090 T71A probably benign Het
Usp20 C T 2: 31,017,758 R711C possibly damaging Het
Vmn1r181 G A 7: 23,984,758 R216Q probably benign Het
Vmn2r8 A T 5: 108,801,891 F363L probably benign Het
Vsnl1 T A 12: 11,332,155 N75I probably damaging Het
Wdr55 A T 18: 36,762,069 D96V probably damaging Het
Wls T A 3: 159,934,371 probably null Het
Zc3h13 A G 14: 75,308,915 D152G probably damaging Het
Zc3h18 A G 8: 122,383,865 E151G probably benign Het
Zfat A G 15: 68,084,462 S1174P probably damaging Het
Zfyve9 T A 4: 108,674,488 T416S probably damaging Het
Other mutations in Eif5b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00334:Eif5b APN 1 38041719 missense probably damaging 1.00
IGL01377:Eif5b APN 1 38036098 missense probably benign
IGL01395:Eif5b APN 1 38037258 missense probably damaging 0.96
IGL01572:Eif5b APN 1 38022254 nonsense probably null
IGL01615:Eif5b APN 1 38045706 missense probably damaging 1.00
IGL02141:Eif5b APN 1 38032322 missense probably benign 0.09
IGL02260:Eif5b APN 1 38045456 missense possibly damaging 0.81
IGL02308:Eif5b APN 1 38041747 missense probably damaging 1.00
IGL03180:Eif5b APN 1 38036269 missense probably damaging 1.00
IGL03327:Eif5b APN 1 38041691 splice site probably benign
R0018:Eif5b UTSW 1 38018889 missense unknown
R0036:Eif5b UTSW 1 38019111 missense probably benign 0.23
R0137:Eif5b UTSW 1 38019243 missense probably benign 0.23
R0349:Eif5b UTSW 1 38032366 missense probably benign 0.18
R0606:Eif5b UTSW 1 38048893 missense probably damaging 1.00
R1056:Eif5b UTSW 1 38022167 missense unknown
R1225:Eif5b UTSW 1 38037628 missense probably damaging 1.00
R2043:Eif5b UTSW 1 38041819 missense probably damaging 1.00
R2163:Eif5b UTSW 1 38048794 missense probably benign 0.32
R2225:Eif5b UTSW 1 38019223 missense unknown
R2432:Eif5b UTSW 1 38019342 missense unknown
R2922:Eif5b UTSW 1 38018019 splice site probably benign
R4357:Eif5b UTSW 1 38050258 missense probably damaging 1.00
R4631:Eif5b UTSW 1 38041747 missense probably damaging 1.00
R4665:Eif5b UTSW 1 38045712 missense probably damaging 1.00
R4702:Eif5b UTSW 1 38018877 missense unknown
R4941:Eif5b UTSW 1 38051199 missense probably damaging 1.00
R4995:Eif5b UTSW 1 38051711 makesense probably null
R5020:Eif5b UTSW 1 38019069 nonsense probably null
R5175:Eif5b UTSW 1 38045387 missense probably damaging 1.00
R5375:Eif5b UTSW 1 38045754 missense possibly damaging 0.66
R5566:Eif5b UTSW 1 38045684 missense possibly damaging 0.90
R5566:Eif5b UTSW 1 38051247 missense probably damaging 1.00
R5853:Eif5b UTSW 1 38037307 missense probably damaging 1.00
R5978:Eif5b UTSW 1 37998280 unclassified probably null
R6376:Eif5b UTSW 1 38045679 missense probably damaging 0.98
R6388:Eif5b UTSW 1 38019000 missense unknown
R6444:Eif5b UTSW 1 38036211 missense probably damaging 1.00
R6455:Eif5b UTSW 1 38019027 missense probably benign 0.23
R6810:Eif5b UTSW 1 38046660 missense probably benign 0.45
R6877:Eif5b UTSW 1 38050239 missense probably damaging 1.00
R7130:Eif5b UTSW 1 38041776 missense probably damaging 1.00
R7180:Eif5b UTSW 1 38049074 missense probably damaging 0.98
R7439:Eif5b UTSW 1 38051637 missense probably benign 0.28
R7488:Eif5b UTSW 1 38050306 missense possibly damaging 0.69
Predicted Primers PCR Primer
(F):5'- GCCTTGGCTGCAGAAATAGAAG -3'
(R):5'- CTGACCCCAAGTGGATCAAG -3'

Sequencing Primer
(F):5'- CTGCAGAAATAGAAGGAGCTGGTG -3'
(R):5'- CTGACCCCAAGTGGATCAAGTTTATC -3'
Posted On2018-04-02