Incidental Mutation 'R6315:Usp20'
ID 510567
Institutional Source Beutler Lab
Gene Symbol Usp20
Ensembl Gene ENSMUSG00000026854
Gene Name ubiquitin specific peptidase 20
Synonyms 1700055M05Rik, Vdu2
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R6315 (G1)
Quality Score 225.009
Status Validated
Chromosome 2
Chromosomal Location 30982279-31023586 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 31017758 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Arginine to Cysteine at position 711 (R711C)
Ref Sequence ENSEMBL: ENSMUSP00000127388 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102849] [ENSMUST00000170476]
AlphaFold Q8C6M1
Predicted Effect possibly damaging
Transcript: ENSMUST00000102849
AA Change: R711C

PolyPhen 2 Score 0.696 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000099913
Gene: ENSMUSG00000026854
AA Change: R711C

DomainStartEndE-ValueType
Pfam:zf-UBP 30 95 4.3e-17 PFAM
low complexity region 128 138 N/A INTRINSIC
Pfam:UCH 144 684 5e-63 PFAM
Pfam:UCH_1 145 669 8.8e-24 PFAM
DUSP 704 787 5.97e-28 SMART
DUSP 812 897 4.74e-31 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127776
Predicted Effect possibly damaging
Transcript: ENSMUST00000170476
AA Change: R711C

PolyPhen 2 Score 0.696 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000127388
Gene: ENSMUSG00000026854
AA Change: R711C

DomainStartEndE-ValueType
Pfam:zf-UBP 30 95 3.4e-17 PFAM
low complexity region 128 138 N/A INTRINSIC
Pfam:UCH 144 270 1.2e-26 PFAM
Pfam:UCH_1 145 669 6.1e-20 PFAM
Pfam:UCH 324 684 1.6e-31 PFAM
DUSP 704 787 5.97e-28 SMART
DUSP 812 897 4.74e-31 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 97% (64/66)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a ubiquitin specific processing protease that was first identified as a substrate of the VHL (von Hippel-Lindau disease) protein E3 ubiquitin ligase complex. In addition to being ubiquitinated by the VHL-E3 ligase complex, this enzyme deubiquitinates hypoxia-inducible factor (HIF)-1 alpha and thereby causes increased expression of HIF-1alpha targeted genes which play a role in angiogenesis, glucose metabolism, cell proliferation and metastasis. The enzyme encoded by this gene also regulates G-protein coupled receptor signaling by mediating the deubiquitination of beta-2 adrenergic receptor (ADRB2). This enzyme is a ubiquitously expressed thiolester hydrolase. Alternative splicing results in multiple transcript variants encoding the same protein. [provided by RefSeq, Jan 2013]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca15 T C 7: 120,346,092 Y464H probably damaging Het
Ahnak T C 19: 9,006,626 M1758T probably damaging Het
Ak9 A T 10: 41,406,841 D1201V possibly damaging Het
Amdhd2 A C 17: 24,158,356 H203Q probably benign Het
Ano3 A G 2: 110,697,039 M608T probably damaging Het
Arhgef4 G A 1: 34,723,477 A605T unknown Het
Atp1a2 C G 1: 172,289,336 R238P probably damaging Het
Atp8b1 C A 18: 64,531,479 R1206L probably damaging Het
B4galt5 A T 2: 167,305,809 N215K probably damaging Het
Bpifa1 A G 2: 154,146,076 K180E possibly damaging Het
Cadm1 C T 9: 47,810,119 T269M probably damaging Het
Cadm3 T C 1: 173,344,352 D252G probably benign Het
Ccdc18 A G 5: 108,161,582 R348G probably benign Het
Cers4 G A 8: 4,516,980 C94Y probably benign Het
Cfap58 G A 19: 47,941,277 R59H probably benign Het
Col19a1 C T 1: 24,526,452 G266D unknown Het
Col6a5 G T 9: 105,881,970 F2012L probably damaging Het
Dnah6 T C 6: 73,191,605 Q445R probably benign Het
Dsg3 A G 18: 20,524,586 S238G probably benign Het
E130308A19Rik G A 4: 59,691,132 S322N probably benign Het
Eif5b A G 1: 38,018,033 D57G unknown Het
Fbn2 T C 18: 58,054,953 probably null Het
Fbxo38 A T 18: 62,536,147 C77* probably null Het
Fgb T A 3: 83,045,055 Q169L probably benign Het
Fut9 A T 4: 25,619,774 Y347N probably damaging Het
Gabrg2 T C 11: 41,971,861 K132R probably damaging Het
Gpn3 C T 5: 122,372,575 probably benign Het
Helz2 A G 2: 181,233,202 L1833P probably damaging Het
Hk3 C T 13: 55,011,157 D484N probably benign Het
Icam4 T C 9: 21,029,952 V129A probably damaging Het
Impdh2 T C 9: 108,563,439 S280P possibly damaging Het
Impg1 C A 9: 80,394,074 G267V probably benign Het
Iqgap1 C T 7: 80,799,890 V39M possibly damaging Het
Lyst A G 13: 13,643,504 N1253S probably benign Het
Mgat4b T A 11: 50,231,764 V195E probably damaging Het
Mrgprb8 C T 7: 48,389,235 T218I probably damaging Het
Myrfl T G 10: 116,822,819 E411A possibly damaging Het
Myt1l T C 12: 29,827,798 S483P unknown Het
Neil2 A G 14: 63,183,471 V80A possibly damaging Het
Nfe2l2 G T 2: 75,676,819 D312E probably damaging Het
Nin A T 12: 70,045,615 L640Q probably damaging Het
Nup205 T A 6: 35,236,869 I1732N probably damaging Het
Nupl2 T C 5: 24,167,504 S97P probably damaging Het
Olfr1468-ps1 T C 19: 13,375,405 C148R unknown Het
Olfr180 A C 16: 58,916,246 Y132D probably damaging Het
Plcb1 A T 2: 135,346,341 T785S probably benign Het
Plch1 C T 3: 63,781,390 W131* probably null Het
Ppp1r1b A G 11: 98,355,390 E66G probably damaging Het
Ros1 A T 10: 52,118,210 W1325R probably benign Het
Sec14l5 A C 16: 5,180,277 E500A possibly damaging Het
Sirpb1c A G 3: 15,832,306 V302A possibly damaging Het
Spata19 T C 9: 27,400,837 Y107H possibly damaging Het
Sv2a G A 3: 96,188,186 M298I probably benign Het
Tdrd6 A T 17: 43,626,338 M1273K probably benign Het
Tectb A G 19: 55,191,472 H250R possibly damaging Het
Trip11 T G 12: 101,885,578 E742D possibly damaging Het
Tslp A G 18: 32,817,090 T71A probably benign Het
Vmn1r181 G A 7: 23,984,758 R216Q probably benign Het
Vmn2r8 A T 5: 108,801,891 F363L probably benign Het
Vsnl1 T A 12: 11,332,155 N75I probably damaging Het
Wdr55 A T 18: 36,762,069 D96V probably damaging Het
Wls T A 3: 159,934,371 probably null Het
Zc3h13 A G 14: 75,308,915 D152G probably damaging Het
Zc3h18 A G 8: 122,383,865 E151G probably benign Het
Zfat A G 15: 68,084,462 S1174P probably damaging Het
Zfyve9 T A 4: 108,674,488 T416S probably damaging Het
Other mutations in Usp20
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00973:Usp20 APN 2 31004950 missense probably damaging 1.00
IGL01444:Usp20 APN 2 30998789 start codon destroyed probably null 1.00
IGL01601:Usp20 APN 2 31011794 missense probably benign 0.04
IGL01785:Usp20 APN 2 31017163 missense probably benign 0.02
IGL01786:Usp20 APN 2 31017163 missense probably benign 0.02
IGL02129:Usp20 APN 2 31004450 missense probably benign 0.43
IGL02147:Usp20 APN 2 31006401 missense probably damaging 1.00
IGL03396:Usp20 APN 2 31011717 missense probably benign
BB007:Usp20 UTSW 2 31010544 missense probably benign 0.21
BB017:Usp20 UTSW 2 31010544 missense probably benign 0.21
PIT4453001:Usp20 UTSW 2 31017486 missense possibly damaging 0.47
R0111:Usp20 UTSW 2 31002612 missense probably damaging 1.00
R0369:Usp20 UTSW 2 31011104 missense probably benign 0.00
R0479:Usp20 UTSW 2 31017475 missense probably benign 0.18
R0538:Usp20 UTSW 2 31004450 missense probably damaging 0.99
R1023:Usp20 UTSW 2 31007813 missense probably damaging 1.00
R1183:Usp20 UTSW 2 31011785 missense probably benign 0.17
R1635:Usp20 UTSW 2 31018818 missense probably benign 0.03
R2114:Usp20 UTSW 2 31016305 missense probably damaging 1.00
R2115:Usp20 UTSW 2 31016305 missense probably damaging 1.00
R2116:Usp20 UTSW 2 31016305 missense probably damaging 1.00
R2117:Usp20 UTSW 2 31016305 missense probably damaging 1.00
R2232:Usp20 UTSW 2 31018738 missense probably benign 0.13
R2244:Usp20 UTSW 2 31010331 missense possibly damaging 0.65
R2883:Usp20 UTSW 2 31018800 missense probably benign
R4734:Usp20 UTSW 2 31019824 missense probably benign 0.31
R5507:Usp20 UTSW 2 31010226 missense probably benign
R5770:Usp20 UTSW 2 31017508 missense probably damaging 1.00
R5862:Usp20 UTSW 2 31006449 nonsense probably null
R7603:Usp20 UTSW 2 31011474 missense probably damaging 1.00
R7887:Usp20 UTSW 2 31020894 missense probably benign 0.34
R7930:Usp20 UTSW 2 31010544 missense probably benign 0.21
R8542:Usp20 UTSW 2 31011624 missense possibly damaging 0.94
R8965:Usp20 UTSW 2 31011785 missense possibly damaging 0.77
R9079:Usp20 UTSW 2 31005108 intron probably benign
R9226:Usp20 UTSW 2 31017400 missense probably damaging 0.99
R9417:Usp20 UTSW 2 30983018 critical splice acceptor site probably null
R9459:Usp20 UTSW 2 31011012 missense probably damaging 0.99
Z1176:Usp20 UTSW 2 31019818 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- TGTCCCAGCATGCTAAAGG -3'
(R):5'- ACCAGGTCATCGATGTAGTGG -3'

Sequencing Primer
(F):5'- TAAAGGGTGGCTCTGCACAC -3'
(R):5'- CCAGGTCATCGATGTAGTGGTATTTG -3'
Posted On 2018-04-02