Incidental Mutation 'R6315:Sirpb1c'
ID510574
Institutional Source Beutler Lab
Gene Symbol Sirpb1c
Ensembl Gene ENSMUSG00000074677
Gene Namesignal-regulatory protein beta 1C
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.055) question?
Stock #R6315 (G1)
Quality Score101.008
Status Not validated
Chromosome3
Chromosomal Location15795145-15848528 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 15832306 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 302 (V302A)
Ref Sequence ENSEMBL: ENSMUSP00000103991 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050623] [ENSMUST00000108349] [ENSMUST00000108350] [ENSMUST00000108352] [ENSMUST00000108354]
Predicted Effect probably benign
Transcript: ENSMUST00000050623
AA Change: V302A

PolyPhen 2 Score 0.354 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000061216
Gene: ENSMUSG00000074677
AA Change: V302A

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
IG 37 143 3.51e-8 SMART
IGc1 163 236 4.07e-4 SMART
IGc1 266 339 2.21e-5 SMART
transmembrane domain 364 386 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000108349
AA Change: V300A

PolyPhen 2 Score 0.710 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000103986
Gene: ENSMUSG00000074677
AA Change: V300A

DomainStartEndE-ValueType
low complexity region 15 23 N/A INTRINSIC
IG 35 141 3.51e-8 SMART
IGc1 161 234 4.07e-4 SMART
IGc1 264 337 2.21e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000108350
AA Change: V302A

PolyPhen 2 Score 0.354 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000103987
Gene: ENSMUSG00000074677
AA Change: V302A

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
IG 37 143 3.51e-8 SMART
IGc1 163 236 4.07e-4 SMART
IGc1 266 339 2.21e-5 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000108352
AA Change: V302A

PolyPhen 2 Score 0.526 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000103989
Gene: ENSMUSG00000074677
AA Change: V302A

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
IG 37 143 3.51e-8 SMART
IGc1 163 236 4.07e-4 SMART
IGc1 266 339 2.21e-5 SMART
transmembrane domain 370 392 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000108354
AA Change: V302A

PolyPhen 2 Score 0.710 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000103991
Gene: ENSMUSG00000074677
AA Change: V302A

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
IG 37 143 3.51e-8 SMART
IGc1 163 236 4.07e-4 SMART
IGc1 266 339 2.21e-5 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124067
Predicted Effect unknown
Transcript: ENSMUST00000148194
AA Change: V170A
SMART Domains Protein: ENSMUSP00000120527
Gene: ENSMUSG00000074677
AA Change: V170A

DomainStartEndE-ValueType
IGc1 32 105 4.07e-4 SMART
IGc1 135 208 2.21e-5 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 97% (64/66)
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca15 T C 7: 120,346,092 Y464H probably damaging Het
Ahnak T C 19: 9,006,626 M1758T probably damaging Het
Ak9 A T 10: 41,406,841 D1201V possibly damaging Het
Amdhd2 A C 17: 24,158,356 H203Q probably benign Het
Ano3 A G 2: 110,697,039 M608T probably damaging Het
Arhgef4 G A 1: 34,723,477 A605T unknown Het
Atp1a2 C G 1: 172,289,336 R238P probably damaging Het
Atp8b1 C A 18: 64,531,479 R1206L probably damaging Het
B4galt5 A T 2: 167,305,809 N215K probably damaging Het
Bpifa1 A G 2: 154,146,076 K180E possibly damaging Het
Cadm1 C T 9: 47,810,119 T269M probably damaging Het
Cadm3 T C 1: 173,344,352 D252G probably benign Het
Ccdc18 A G 5: 108,161,582 R348G probably benign Het
Cers4 G A 8: 4,516,980 C94Y probably benign Het
Cfap58 G A 19: 47,941,277 R59H probably benign Het
Col19a1 C T 1: 24,526,452 G266D unknown Het
Col6a5 G T 9: 105,881,970 F2012L probably damaging Het
Dnah6 T C 6: 73,191,605 Q445R probably benign Het
Dsg3 A G 18: 20,524,586 S238G probably benign Het
E130308A19Rik G A 4: 59,691,132 S322N probably benign Het
Eif5b A G 1: 38,018,033 D57G unknown Het
Fbn2 T C 18: 58,054,953 probably null Het
Fbxo38 A T 18: 62,536,147 C77* probably null Het
Fgb T A 3: 83,045,055 Q169L probably benign Het
Fut9 A T 4: 25,619,774 Y347N probably damaging Het
Gabrg2 T C 11: 41,971,861 K132R probably damaging Het
Gpn3 C T 5: 122,372,575 probably benign Het
Helz2 A G 2: 181,233,202 L1833P probably damaging Het
Hk3 C T 13: 55,011,157 D484N probably benign Het
Icam4 T C 9: 21,029,952 V129A probably damaging Het
Impdh2 T C 9: 108,563,439 S280P possibly damaging Het
Impg1 C A 9: 80,394,074 G267V probably benign Het
Iqgap1 C T 7: 80,799,890 V39M possibly damaging Het
Lyst A G 13: 13,643,504 N1253S probably benign Het
Mgat4b T A 11: 50,231,764 V195E probably damaging Het
Mrgprb8 C T 7: 48,389,235 T218I probably damaging Het
Myrfl T G 10: 116,822,819 E411A possibly damaging Het
Myt1l T C 12: 29,827,798 S483P unknown Het
Neil2 A G 14: 63,183,471 V80A possibly damaging Het
Nfe2l2 G T 2: 75,676,819 D312E probably damaging Het
Nin A T 12: 70,045,615 L640Q probably damaging Het
Nup205 T A 6: 35,236,869 I1732N probably damaging Het
Nupl2 T C 5: 24,167,504 S97P probably damaging Het
Olfr1468-ps1 T C 19: 13,375,405 C148R unknown Het
Olfr180 A C 16: 58,916,246 Y132D probably damaging Het
Plcb1 A T 2: 135,346,341 T785S probably benign Het
Plch1 C T 3: 63,781,390 W131* probably null Het
Ppp1r1b A G 11: 98,355,390 E66G probably damaging Het
Ros1 A T 10: 52,118,210 W1325R probably benign Het
Sec14l5 A C 16: 5,180,277 E500A possibly damaging Het
Spata19 T C 9: 27,400,837 Y107H possibly damaging Het
Sv2a G A 3: 96,188,186 M298I probably benign Het
Tdrd6 A T 17: 43,626,338 M1273K probably benign Het
Tectb A G 19: 55,191,472 H250R possibly damaging Het
Trip11 T G 12: 101,885,578 E742D possibly damaging Het
Tslp A G 18: 32,817,090 T71A probably benign Het
Usp20 C T 2: 31,017,758 R711C possibly damaging Het
Vmn1r181 G A 7: 23,984,758 R216Q probably benign Het
Vmn2r8 A T 5: 108,801,891 F363L probably benign Het
Vsnl1 T A 12: 11,332,155 N75I probably damaging Het
Wdr55 A T 18: 36,762,069 D96V probably damaging Het
Wls T A 3: 159,934,371 probably null Het
Zc3h13 A G 14: 75,308,915 D152G probably damaging Het
Zc3h18 A G 8: 122,383,865 E151G probably benign Het
Zfat A G 15: 68,084,462 S1174P probably damaging Het
Zfyve9 T A 4: 108,674,488 T416S probably damaging Het
Other mutations in Sirpb1c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01963:Sirpb1c APN 3 15838773 missense probably benign 0.06
R0094:Sirpb1c UTSW 3 15838758 missense possibly damaging 0.73
R0356:Sirpb1c UTSW 3 15833145 missense possibly damaging 0.95
R0442:Sirpb1c UTSW 3 15802546 missense probably benign 0.09
R3731:Sirpb1c UTSW 3 15833123 missense probably damaging 1.00
R4812:Sirpb1c UTSW 3 15833222 missense probably damaging 0.99
R5802:Sirpb1c UTSW 3 15832076 missense probably benign 0.00
R7107:Sirpb1c UTSW 3 15838777 missense possibly damaging 0.91
R7148:Sirpb1c UTSW 3 15833059 nonsense probably null
R7349:Sirpb1c UTSW 3 15832146 critical splice donor site probably null
R7356:Sirpb1c UTSW 3 15832133 missense probably benign
R7359:Sirpb1c UTSW 3 15833225 missense probably benign 0.02
R7466:Sirpb1c UTSW 3 15832266 missense probably damaging 1.00
R7629:Sirpb1c UTSW 3 15848395 missense possibly damaging 0.86
R7720:Sirpb1c UTSW 3 15832072 missense probably benign 0.00
R7726:Sirpb1c UTSW 3 15848386 missense possibly damaging 0.92
R7853:Sirpb1c UTSW 3 15832992 missense probably damaging 1.00
R7886:Sirpb1c UTSW 3 15832202 missense probably benign 0.10
R7936:Sirpb1c UTSW 3 15832992 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGTAGCAGTACCTTTCACTCTC -3'
(R):5'- GGTGGATCCTTAACATTCAGCTC -3'

Sequencing Primer
(F):5'- CTGATGTTCAGTGACCACCAC -3'
(R):5'- AGAATGTCTGTGCCTAGGTTCCATC -3'
Posted On2018-04-02