Mutagenetix > Incidental Mutations

Incidental Mutation 'R6315:Plch1'

510575

Institutional Source

Beutler Lab

Gene Symbol

Plch1

Ensembl Gene

ENSMUSG00000036834

Gene Name

phospholipase C, eta 1

Synonyms

PLCeta1, Plcl3

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.171) question?

Stock #

R6315 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

63696234-63899472 bp(-) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

C to T at 63781390 bp

Zygosity

Heterozygous

Amino Acid Change

Tryptophan to Stop codon at position 131 (W131*)

Ref Sequence

ENSEMBL: ENSMUSP00000135424 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000048134] [ENSMUST00000059973] [ENSMUST00000084105] [ENSMUST00000159188] [ENSMUST00000159676] [ENSMUST00000160638] [ENSMUST00000162269] [ENSMUST00000175947] [ENSMUST00000177143]

Predicted Effect

probably null
Transcript: ENSMUST00000048134
AA Change: W101*

SMART Domains

Protein: ENSMUSP00000047693
Gene: ENSMUSG00000036834
AA Change: W101*

Domain	Start	End	E-Value	Type
PH	3	112	2.37e-6	SMART
EFh	128	156	2.41e-4	SMART
EFh	164	193	1.54e-2	SMART
Pfam:EF-hand_like	198	280	2.2e-26	PFAM
PLCXc	281	426	3.13e-71	SMART
low complexity region	440	453	N/A	INTRINSIC
low complexity region	564	581	N/A	INTRINSIC
PLCYc	583	696	3.4e-49	SMART
C2	715	823	5.47e-22	SMART
low complexity region	979	997	N/A	INTRINSIC
low complexity region	1079	1091	N/A	INTRINSIC
low complexity region	1420	1435	N/A	INTRINSIC
low complexity region	1543	1557	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000059973
AA Change: W119*

SMART Domains

Protein: ENSMUSP00000058524
Gene: ENSMUSG00000036834
AA Change: W119*

Domain	Start	End	E-Value	Type
PH	21	130	1.1e-8	SMART
EFh	146	174	1.1e-6	SMART
EFh	182	211	7.6e-5	SMART
Pfam:EF-hand_like	216	298	4.5e-24	PFAM
PLCXc	299	444	1.6e-73	SMART
low complexity region	458	471	N/A	INTRINSIC
low complexity region	582	599	N/A	INTRINSIC
PLCYc	601	714	1.7e-51	SMART
C2	733	841	3.7e-24	SMART
low complexity region	1017	1035	N/A	INTRINSIC
low complexity region	1117	1129	N/A	INTRINSIC
low complexity region	1458	1473	N/A	INTRINSIC
low complexity region	1581	1595	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000084105
AA Change: W119*

SMART Domains

Protein: ENSMUSP00000081122
Gene: ENSMUSG00000036834
AA Change: W119*

Domain	Start	End	E-Value	Type
PH	21	130	2.37e-6	SMART
EFh	146	174	2.41e-4	SMART
EFh	182	211	1.54e-2	SMART
Pfam:EF-hand_like	216	298	2.4e-27	PFAM
PLCXc	299	444	3.13e-71	SMART
low complexity region	458	471	N/A	INTRINSIC
low complexity region	583	600	N/A	INTRINSIC
PLCYc	602	715	3.4e-49	SMART
C2	734	842	5.47e-22	SMART
low complexity region	1018	1036	N/A	INTRINSIC
low complexity region	1118	1130	N/A	INTRINSIC
low complexity region	1459	1474	N/A	INTRINSIC
low complexity region	1582	1596	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000159188
AA Change: W131*

SMART Domains

Protein: ENSMUSP00000124491
Gene: ENSMUSG00000036834
AA Change: W131*

Domain	Start	End	E-Value	Type
SCOP:d1mai__	28	135	2e-29	SMART
PDB:1MAI\|A	31	135	1e-5	PDB
Blast:PH	33	135	1e-72	BLAST

Predicted Effect

probably null
Transcript: ENSMUST00000159676
AA Change: W119*

SMART Domains

Protein: ENSMUSP00000124632
Gene: ENSMUSG00000036834
AA Change: W119*

Domain	Start	End	E-Value	Type
PH	21	130	2.37e-6	SMART
EFh	146	174	2.41e-4	SMART
EFh	182	211	1.54e-2	SMART
Pfam:EF-hand_like	216	298	1.8e-26	PFAM
PLCXc	299	444	3.13e-71	SMART
low complexity region	458	471	N/A	INTRINSIC
low complexity region	583	600	N/A	INTRINSIC
PLCYc	602	715	3.4e-49	SMART
C2	734	842	5.47e-22	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000160638
AA Change: W119*

SMART Domains

Protein: ENSMUSP00000123921
Gene: ENSMUSG00000036834
AA Change: W119*

Domain	Start	End	E-Value	Type
PH	21	130	2.37e-6	SMART
EFh	146	174	2.41e-4	SMART
EFh	182	211	1.54e-2	SMART
Pfam:EF-hand_like	216	298	5.3e-28	PFAM
PLCXc	299	444	3.13e-71	SMART
low complexity region	458	471	N/A	INTRINSIC
low complexity region	583	600	N/A	INTRINSIC
PLCYc	602	715	3.4e-49	SMART
C2	734	842	5.47e-22	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000162269
AA Change: W119*

SMART Domains

Protein: ENSMUSP00000124463
Gene: ENSMUSG00000036834
AA Change: W119*

Domain	Start	End	E-Value	Type
PH	21	130	2.37e-6	SMART
EFh	146	174	2.41e-4	SMART
EFh	182	211	1.54e-2	SMART
Pfam:EF-hand_like	216	298	1.7e-26	PFAM
PLCXc	299	444	3.13e-71	SMART
low complexity region	458	471	N/A	INTRINSIC
low complexity region	583	600	N/A	INTRINSIC
PLCYc	602	715	3.4e-49	SMART
C2	734	842	5.47e-22	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000175947
AA Change: W119*

SMART Domains

Protein: ENSMUSP00000135353
Gene: ENSMUSG00000036834
AA Change: W119*

Domain	Start	End	E-Value	Type
PH	21	130	2.37e-6	SMART
EFh	146	174	2.41e-4	SMART
EFh	182	211	1.54e-2	SMART
Pfam:EF-hand_like	216	298	1.2e-26	PFAM
PLCXc	299	444	3.13e-71	SMART
low complexity region	458	471	N/A	INTRINSIC
low complexity region	582	599	N/A	INTRINSIC
PLCYc	601	714	3.4e-49	SMART
C2	733	841	5.47e-22	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000177143
AA Change: W131*

SMART Domains

Protein: ENSMUSP00000135424
Gene: ENSMUSG00000036834
AA Change: W131*

Domain	Start	End	E-Value	Type
PH	33	142	2.37e-6	SMART
EFh	158	186	2.41e-4	SMART
EFh	194	223	1.54e-2	SMART
Pfam:EF-hand_like	228	310	2.3e-26	PFAM
PLCXc	311	456	3.13e-71	SMART
low complexity region	470	483	N/A	INTRINSIC
low complexity region	594	611	N/A	INTRINSIC
PLCYc	613	726	3.4e-49	SMART
C2	745	853	5.47e-22	SMART
low complexity region	1009	1027	N/A	INTRINSIC
low complexity region	1109	1121	N/A	INTRINSIC
low complexity region	1450	1465	N/A	INTRINSIC
low complexity region	1573	1587	N/A	INTRINSIC

Meta Mutation Damage Score

0.9755

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.8%

Validation Efficiency

97% (64/66)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] PLCH1 is a member of the PLC-eta family of the phosphoinositide-specific phospholipase C (PLC) superfamily of enzymes that cleave phosphatidylinositol 4,5-bisphosphate (PtdIns(4,5)P2) to generate second messengers inositol 1,4,5-trisphosphate (IP3) and diacylglycerol (DAG) (Hwang et al., 2005 [PubMed 15702972]).[supplied by OMIM, Jun 2009]

Allele List at MGI

Other mutations in this stock

Total: 66 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca15	T	C	7: 120,346,092	Y464H	probably damaging	Het
Ahnak	T	C	19: 9,006,626	M1758T	probably damaging	Het
Ak9	A	T	10: 41,406,841	D1201V	possibly damaging	Het
Amdhd2	A	C	17: 24,158,356	H203Q	probably benign	Het
Ano3	A	G	2: 110,697,039	M608T	probably damaging	Het
Arhgef4	G	A	1: 34,723,477	A605T	unknown	Het
Atp1a2	C	G	1: 172,289,336	R238P	probably damaging	Het
Atp8b1	C	A	18: 64,531,479	R1206L	probably damaging	Het
B4galt5	A	T	2: 167,305,809	N215K	probably damaging	Het
Bpifa1	A	G	2: 154,146,076	K180E	possibly damaging	Het
Cadm1	C	T	9: 47,810,119	T269M	probably damaging	Het
Cadm3	T	C	1: 173,344,352	D252G	probably benign	Het
Ccdc18	A	G	5: 108,161,582	R348G	probably benign	Het
Cers4	G	A	8: 4,516,980	C94Y	probably benign	Het
Cfap58	G	A	19: 47,941,277	R59H	probably benign	Het
Col19a1	C	T	1: 24,526,452	G266D	unknown	Het
Col6a5	G	T	9: 105,881,970	F2012L	probably damaging	Het
Dnah6	T	C	6: 73,191,605	Q445R	probably benign	Het
Dsg3	A	G	18: 20,524,586	S238G	probably benign	Het
E130308A19Rik	G	A	4: 59,691,132	S322N	probably benign	Het
Eif5b	A	G	1: 38,018,033	D57G	unknown	Het
Fbn2	T	C	18: 58,054,953		probably null	Het
Fbxo38	A	T	18: 62,536,147	C77*	probably null	Het
Fgb	T	A	3: 83,045,055	Q169L	probably benign	Het
Fut9	A	T	4: 25,619,774	Y347N	probably damaging	Het
Gabrg2	T	C	11: 41,971,861	K132R	probably damaging	Het
Gpn3	C	T	5: 122,372,575		probably benign	Het
Helz2	A	G	2: 181,233,202	L1833P	probably damaging	Het
Hk3	C	T	13: 55,011,157	D484N	probably benign	Het
Icam4	T	C	9: 21,029,952	V129A	probably damaging	Het
Impdh2	T	C	9: 108,563,439	S280P	possibly damaging	Het
Impg1	C	A	9: 80,394,074	G267V	probably benign	Het
Iqgap1	C	T	7: 80,799,890	V39M	possibly damaging	Het
Lyst	A	G	13: 13,643,504	N1253S	probably benign	Het
Mgat4b	T	A	11: 50,231,764	V195E	probably damaging	Het
Mrgprb8	C	T	7: 48,389,235	T218I	probably damaging	Het
Myrfl	T	G	10: 116,822,819	E411A	possibly damaging	Het
Myt1l	T	C	12: 29,827,798	S483P	unknown	Het
Neil2	A	G	14: 63,183,471	V80A	possibly damaging	Het
Nfe2l2	G	T	2: 75,676,819	D312E	probably damaging	Het
Nin	A	T	12: 70,045,615	L640Q	probably damaging	Het
Nup205	T	A	6: 35,236,869	I1732N	probably damaging	Het
Nupl2	T	C	5: 24,167,504	S97P	probably damaging	Het
Olfr1468-ps1	T	C	19: 13,375,405	C148R	unknown	Het
Olfr180	A	C	16: 58,916,246	Y132D	probably damaging	Het
Plcb1	A	T	2: 135,346,341	T785S	probably benign	Het
Ppp1r1b	A	G	11: 98,355,390	E66G	probably damaging	Het
Ros1	A	T	10: 52,118,210	W1325R	probably benign	Het
Sec14l5	A	C	16: 5,180,277	E500A	possibly damaging	Het
Sirpb1c	A	G	3: 15,832,306	V302A	possibly damaging	Het
Spata19	T	C	9: 27,400,837	Y107H	possibly damaging	Het
Sv2a	G	A	3: 96,188,186	M298I	probably benign	Het
Tdrd6	A	T	17: 43,626,338	M1273K	probably benign	Het
Tectb	A	G	19: 55,191,472	H250R	possibly damaging	Het
Trip11	T	G	12: 101,885,578	E742D	possibly damaging	Het
Tslp	A	G	18: 32,817,090	T71A	probably benign	Het
Usp20	C	T	2: 31,017,758	R711C	possibly damaging	Het
Vmn1r181	G	A	7: 23,984,758	R216Q	probably benign	Het
Vmn2r8	A	T	5: 108,801,891	F363L	probably benign	Het
Vsnl1	T	A	12: 11,332,155	N75I	probably damaging	Het
Wdr55	A	T	18: 36,762,069	D96V	probably damaging	Het
Wls	T	A	3: 159,934,371		probably null	Het
Zc3h13	A	G	14: 75,308,915	D152G	probably damaging	Het
Zc3h18	A	G	8: 122,383,865	E151G	probably benign	Het
Zfat	A	G	15: 68,084,462	S1174P	probably damaging	Het
Zfyve9	T	A	4: 108,674,488	T416S	probably damaging	Het

Other mutations in Plch1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01397:Plch1	APN	3	63731729	splice site	probably null
IGL01542:Plch1	APN	3	63731649	missense	probably damaging	0.99
IGL01999:Plch1	APN	3	63753307	missense	probably damaging	1.00
IGL02153:Plch1	APN	3	63781351	missense	probably damaging	1.00
IGL02203:Plch1	APN	3	63698739	missense	possibly damaging	0.46
IGL02220:Plch1	APN	3	63698961	missense	probably damaging	0.97
IGL02259:Plch1	APN	3	63722749	critical splice donor site	probably null
IGL02268:Plch1	APN	3	63699283	makesense	probably null
IGL02411:Plch1	APN	3	63697756	unclassified	probably null
IGL02472:Plch1	APN	3	63701849	missense	probably damaging	1.00
IGL02477:Plch1	APN	3	63753293	missense	probably damaging	1.00
IGL02503:Plch1	APN	3	63697864	missense	probably damaging	1.00
IGL02800:Plch1	APN	3	63698478	missense	probably benign	0.21
IGL03167:Plch1	APN	3	63722744	splice site	probably benign
IGL03182:Plch1	APN	3	63702594	nonsense	probably null
IGL03197:Plch1	APN	3	63753170	missense	probably damaging	1.00
IGL03251:Plch1	APN	3	63784002	missense	possibly damaging	0.93
R0335:Plch1	UTSW	3	63710978	missense	probably damaging	1.00
R0347:Plch1	UTSW	3	63753316	missense	probably damaging	1.00
R0631:Plch1	UTSW	3	63699219	missense	probably benign	0.23
R0687:Plch1	UTSW	3	63716029	missense	probably damaging	1.00
R0738:Plch1	UTSW	3	63702553	intron	probably benign
R0883:Plch1	UTSW	3	63753256	missense	probably damaging	1.00
R1437:Plch1	UTSW	3	63697533	missense	probably benign	0.37
R1678:Plch1	UTSW	3	63740694	missense	probably damaging	1.00
R1738:Plch1	UTSW	3	63719238	missense	probably benign	0.12
R1929:Plch1	UTSW	3	63744535	missense	probably damaging	1.00
R1955:Plch1	UTSW	3	63755267	missense	probably damaging	0.98
R2078:Plch1	UTSW	3	63701943	missense	probably benign	0.01
R2112:Plch1	UTSW	3	63722806	missense	probably damaging	1.00
R2158:Plch1	UTSW	3	63721234	missense	probably benign	0.00
R2165:Plch1	UTSW	3	63698482	missense	probably benign	0.01
R2259:Plch1	UTSW	3	63697977	missense	possibly damaging	0.94
R2271:Plch1	UTSW	3	63744535	missense	probably damaging	1.00
R3110:Plch1	UTSW	3	63709531	missense	probably damaging	1.00
R3112:Plch1	UTSW	3	63709531	missense	probably damaging	1.00
R3407:Plch1	UTSW	3	63699347	unclassified	probably benign
R3408:Plch1	UTSW	3	63699347	unclassified	probably benign
R3791:Plch1	UTSW	3	63699523	missense	probably benign
R3793:Plch1	UTSW	3	63697831	missense	probably damaging	0.96
R3928:Plch1	UTSW	3	63767623	missense	probably damaging	1.00
R4211:Plch1	UTSW	3	63711219	missense	probably damaging	1.00
R4212:Plch1	UTSW	3	63870759	start gained	probably benign
R4223:Plch1	UTSW	3	63701900	missense	probably damaging	1.00
R4491:Plch1	UTSW	3	63740739	missense	probably damaging	1.00
R4589:Plch1	UTSW	3	63781507	missense	probably damaging	1.00
R4656:Plch1	UTSW	3	63704177	missense	probably damaging	1.00
R4701:Plch1	UTSW	3	63699496	intron	probably null
R4716:Plch1	UTSW	3	63781546	missense	probably damaging	1.00
R4772:Plch1	UTSW	3	63753325	missense	probably damaging	1.00
R4902:Plch1	UTSW	3	63740843	intron	probably benign
R5058:Plch1	UTSW	3	63722781	missense	probably damaging	1.00
R5092:Plch1	UTSW	3	63698710	missense	probably benign	0.02
R5093:Plch1	UTSW	3	63773715	missense	probably damaging	0.99
R5210:Plch1	UTSW	3	63699778	critical splice donor site	probably null
R5368:Plch1	UTSW	3	63701973	missense	possibly damaging	0.82
R5373:Plch1	UTSW	3	63698078	missense	probably benign	0.01
R5374:Plch1	UTSW	3	63698078	missense	probably benign	0.01
R5501:Plch1	UTSW	3	63707741	missense	probably damaging	1.00
R5606:Plch1	UTSW	3	63740687	missense	probably benign	0.35
R5738:Plch1	UTSW	3	63773655	missense	probably damaging	1.00
R5835:Plch1	UTSW	3	63697522	missense	probably benign
R6106:Plch1	UTSW	3	63702023	missense	probably damaging	1.00
R6107:Plch1	UTSW	3	63702023	missense	probably damaging	1.00
R6108:Plch1	UTSW	3	63702023	missense	probably damaging	1.00
R6110:Plch1	UTSW	3	63698858	missense	possibly damaging	0.62
R6116:Plch1	UTSW	3	63702023	missense	probably damaging	1.00
R6147:Plch1	UTSW	3	63722881	missense	probably damaging	1.00
R6195:Plch1	UTSW	3	63740789	missense	probably damaging	1.00
R6316:Plch1	UTSW	3	63781390	nonsense	probably null
R6317:Plch1	UTSW	3	63781390	nonsense	probably null
R6318:Plch1	UTSW	3	63781390	nonsense	probably null
R6324:Plch1	UTSW	3	63781390	nonsense	probably null
R6325:Plch1	UTSW	3	63781390	nonsense	probably null
R6326:Plch1	UTSW	3	63781390	nonsense	probably null
R6479:Plch1	UTSW	3	63744510	missense	probably benign	0.06
R6544:Plch1	UTSW	3	63850978	missense	probably damaging	1.00
R6767:Plch1	UTSW	3	63755344	missense	probably damaging	1.00
R6829:Plch1	UTSW	3	63697518	missense	probably damaging	0.99
R6891:Plch1	UTSW	3	63698083	missense	probably benign
R6893:Plch1	UTSW	3	63753141	nonsense	probably null
R6921:Plch1	UTSW	3	63707734	missense	possibly damaging	0.90
R7298:Plch1	UTSW	3	63716037	nonsense	probably null
R7396:Plch1	UTSW	3	63698954	missense	probably benign	0.00
R7420:Plch1	UTSW	3	63722857	missense	probably damaging	1.00
R7566:Plch1	UTSW	3	63781242	intron	probably null
R7572:Plch1	UTSW	3	63740684	missense	possibly damaging	0.89
R7649:Plch1	UTSW	3	63698169	nonsense	probably null
R7696:Plch1	UTSW	3	63755305	missense	probably benign
RF018:Plch1	UTSW	3	63721215	missense	probably damaging	1.00
X0028:Plch1	UTSW	3	63744509	missense	possibly damaging	0.94

Predicted Primers

PCR Primer
(F):5'- TCGTATGCTCGTGTGTGCAC -3'
(R):5'- AGCACCACCTTAAGGCAATG -3'

Sequencing Primer
(F):5'- GCACATGCACATACACACAC -3'
(R):5'- ACCAATAAATGTCTTTACCTGCC -3'

Posted On

2018-04-02