Incidental Mutation 'R6315:Fut9'
ID 510579
Institutional Source Beutler Lab
Gene Symbol Fut9
Ensembl Gene ENSMUSG00000055373
Gene Name fucosyltransferase 9
Synonyms mFUT9, mFuc-TIX
MMRRC Submission 044472-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R6315 (G1)
Quality Score 225.009
Status Validated
Chromosome 4
Chromosomal Location 25609333-25800003 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 25619774 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Asparagine at position 347 (Y347N)
Ref Sequence ENSEMBL: ENSMUSP00000103834 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000084770] [ENSMUST00000108199]
AlphaFold O88819
Predicted Effect probably damaging
Transcript: ENSMUST00000084770
AA Change: Y347N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000081826
Gene: ENSMUSG00000055373
AA Change: Y347N

DomainStartEndE-ValueType
Pfam:Glyco_transf_10 6 358 2.9e-140 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000108199
AA Change: Y347N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000103834
Gene: ENSMUSG00000055373
AA Change: Y347N

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
Pfam:Glyco_tran_10_N 61 169 1.4e-43 PFAM
Pfam:Glyco_transf_10 185 357 4.8e-69 PFAM
Meta Mutation Damage Score 0.5698 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 97% (64/66)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the glycosyltransferase family. It is localized to the golgi, and catalyzes the last step in the biosynthesis of Lewis X (LeX) antigen, the addition of a fucose to precursor polysaccharides. This protein is one of the few fucosyltransferases that synthesizes the LeX oligosaccharide (CD15) expressed in the organ buds progressing in mesenchyma during embryogenesis. It is also responsible for the expression of CD15 in mature granulocytes. A common haplotype of this gene has also been associated with susceptibility to placental malaria infection. [provided by RefSeq, Nov 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased number of neuronal stem cells with increased self-renewal capacity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca15 T C 7: 119,945,315 (GRCm39) Y464H probably damaging Het
Ahnak T C 19: 8,983,990 (GRCm39) M1758T probably damaging Het
Ak9 A T 10: 41,282,837 (GRCm39) D1201V possibly damaging Het
Amdhd2 A C 17: 24,377,330 (GRCm39) H203Q probably benign Het
Ano3 A G 2: 110,527,384 (GRCm39) M608T probably damaging Het
Arhgef4 G A 1: 34,762,558 (GRCm39) A605T unknown Het
Atp1a2 C G 1: 172,116,903 (GRCm39) R238P probably damaging Het
Atp8b1 C A 18: 64,664,550 (GRCm39) R1206L probably damaging Het
B4galt5 A T 2: 167,147,729 (GRCm39) N215K probably damaging Het
Bpifa1 A G 2: 153,987,996 (GRCm39) K180E possibly damaging Het
Cadm1 C T 9: 47,721,417 (GRCm39) T269M probably damaging Het
Cadm3 T C 1: 173,171,919 (GRCm39) D252G probably benign Het
Ccdc18 A G 5: 108,309,448 (GRCm39) R348G probably benign Het
Cers4 G A 8: 4,566,980 (GRCm39) C94Y probably benign Het
Cfap58 G A 19: 47,929,716 (GRCm39) R59H probably benign Het
Col19a1 C T 1: 24,565,533 (GRCm39) G266D unknown Het
Col6a5 G T 9: 105,759,169 (GRCm39) F2012L probably damaging Het
Dnah6 T C 6: 73,168,588 (GRCm39) Q445R probably benign Het
Dsg3 A G 18: 20,657,643 (GRCm39) S238G probably benign Het
E130308A19Rik G A 4: 59,691,132 (GRCm39) S322N probably benign Het
Eif5b A G 1: 38,057,114 (GRCm39) D57G unknown Het
Fbn2 T C 18: 58,188,025 (GRCm39) probably null Het
Fbxo38 A T 18: 62,669,218 (GRCm39) C77* probably null Het
Fgb T A 3: 82,952,362 (GRCm39) Q169L probably benign Het
Gabrg2 T C 11: 41,862,688 (GRCm39) K132R probably damaging Het
Gpn3 C T 5: 122,510,638 (GRCm39) probably benign Het
Helz2 A G 2: 180,874,995 (GRCm39) L1833P probably damaging Het
Hk3 C T 13: 55,158,970 (GRCm39) D484N probably benign Het
Icam4 T C 9: 20,941,248 (GRCm39) V129A probably damaging Het
Impdh2 T C 9: 108,440,638 (GRCm39) S280P possibly damaging Het
Impg1 C A 9: 80,301,356 (GRCm39) G267V probably benign Het
Iqgap1 C T 7: 80,449,638 (GRCm39) V39M possibly damaging Het
Lyst A G 13: 13,818,089 (GRCm39) N1253S probably benign Het
Mgat4b T A 11: 50,122,591 (GRCm39) V195E probably damaging Het
Mrgprb8 C T 7: 48,038,983 (GRCm39) T218I probably damaging Het
Myrfl T G 10: 116,658,724 (GRCm39) E411A possibly damaging Het
Myt1l T C 12: 29,877,797 (GRCm39) S483P unknown Het
Neil2 A G 14: 63,420,920 (GRCm39) V80A possibly damaging Het
Nfe2l2 G T 2: 75,507,163 (GRCm39) D312E probably damaging Het
Nin A T 12: 70,092,389 (GRCm39) L640Q probably damaging Het
Nup205 T A 6: 35,213,804 (GRCm39) I1732N probably damaging Het
Nup42 T C 5: 24,372,502 (GRCm39) S97P probably damaging Het
Or5b114-ps1 T C 19: 13,352,769 (GRCm39) C148R unknown Het
Or5k16 A C 16: 58,736,609 (GRCm39) Y132D probably damaging Het
Plcb1 A T 2: 135,188,261 (GRCm39) T785S probably benign Het
Plch1 C T 3: 63,688,811 (GRCm39) W131* probably null Het
Ppp1r1b A G 11: 98,246,216 (GRCm39) E66G probably damaging Het
Ros1 A T 10: 51,994,306 (GRCm39) W1325R probably benign Het
Sec14l5 A C 16: 4,998,141 (GRCm39) E500A possibly damaging Het
Sirpb1c A G 3: 15,886,470 (GRCm39) V302A possibly damaging Het
Spata19 T C 9: 27,312,133 (GRCm39) Y107H possibly damaging Het
Sv2a G A 3: 96,095,502 (GRCm39) M298I probably benign Het
Tdrd6 A T 17: 43,937,229 (GRCm39) M1273K probably benign Het
Tectb A G 19: 55,179,904 (GRCm39) H250R possibly damaging Het
Trip11 T G 12: 101,851,837 (GRCm39) E742D possibly damaging Het
Tslp A G 18: 32,950,143 (GRCm39) T71A probably benign Het
Usp20 C T 2: 30,907,770 (GRCm39) R711C possibly damaging Het
Vmn1r181 G A 7: 23,684,183 (GRCm39) R216Q probably benign Het
Vmn2r8 A T 5: 108,949,757 (GRCm39) F363L probably benign Het
Vsnl1 T A 12: 11,382,156 (GRCm39) N75I probably damaging Het
Wdr55 A T 18: 36,895,122 (GRCm39) D96V probably damaging Het
Wls T A 3: 159,640,007 (GRCm39) probably null Het
Zc3h13 A G 14: 75,546,355 (GRCm39) D152G probably damaging Het
Zc3h18 A G 8: 123,110,604 (GRCm39) E151G probably benign Het
Zfat A G 15: 67,956,311 (GRCm39) S1174P probably damaging Het
Zfyve9 T A 4: 108,531,685 (GRCm39) T416S probably damaging Het
Other mutations in Fut9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00919:Fut9 APN 4 25,620,316 (GRCm39) missense possibly damaging 0.71
IGL01134:Fut9 APN 4 25,620,446 (GRCm39) missense probably benign 0.13
IGL01330:Fut9 APN 4 25,619,791 (GRCm39) missense possibly damaging 0.95
IGL01732:Fut9 APN 4 25,619,867 (GRCm39) missense possibly damaging 0.58
IGL02824:Fut9 APN 4 25,620,037 (GRCm39) missense probably damaging 1.00
ANU74:Fut9 UTSW 4 25,620,802 (GRCm39) missense probably benign 0.25
R0280:Fut9 UTSW 4 25,619,852 (GRCm39) missense probably benign 0.00
R0408:Fut9 UTSW 4 25,620,319 (GRCm39) missense possibly damaging 0.69
R0594:Fut9 UTSW 4 25,620,526 (GRCm39) missense possibly damaging 0.94
R0609:Fut9 UTSW 4 25,620,811 (GRCm39) start codon destroyed probably null 0.98
R0709:Fut9 UTSW 4 25,620,359 (GRCm39) missense probably damaging 1.00
R1567:Fut9 UTSW 4 25,620,344 (GRCm39) missense probably damaging 0.99
R1719:Fut9 UTSW 4 25,619,744 (GRCm39) missense possibly damaging 0.62
R1856:Fut9 UTSW 4 25,620,352 (GRCm39) missense probably damaging 1.00
R2036:Fut9 UTSW 4 25,620,322 (GRCm39) missense probably damaging 1.00
R2165:Fut9 UTSW 4 25,619,734 (GRCm39) makesense probably null
R2165:Fut9 UTSW 4 25,619,733 (GRCm39) makesense probably null
R2332:Fut9 UTSW 4 25,619,823 (GRCm39) nonsense probably null
R4539:Fut9 UTSW 4 25,619,793 (GRCm39) missense probably damaging 1.00
R4722:Fut9 UTSW 4 25,799,734 (GRCm39) utr 5 prime probably benign
R4766:Fut9 UTSW 4 25,799,191 (GRCm39) intron probably benign
R4937:Fut9 UTSW 4 25,799,591 (GRCm39) splice site probably benign
R5025:Fut9 UTSW 4 25,620,502 (GRCm39) missense probably damaging 1.00
R5032:Fut9 UTSW 4 25,799,245 (GRCm39) intron probably benign
R5158:Fut9 UTSW 4 25,620,731 (GRCm39) missense probably benign 0.01
R5601:Fut9 UTSW 4 25,620,299 (GRCm39) missense probably benign 0.00
R5974:Fut9 UTSW 4 25,620,090 (GRCm39) nonsense probably null
R6385:Fut9 UTSW 4 25,620,328 (GRCm39) missense probably damaging 1.00
R6652:Fut9 UTSW 4 25,620,619 (GRCm39) missense probably benign 0.44
R6809:Fut9 UTSW 4 25,620,647 (GRCm39) missense probably benign
R6825:Fut9 UTSW 4 25,619,925 (GRCm39) missense probably benign
R7145:Fut9 UTSW 4 25,620,507 (GRCm39) missense probably damaging 0.96
R7573:Fut9 UTSW 4 25,620,691 (GRCm39) missense probably benign 0.04
R8933:Fut9 UTSW 4 25,619,861 (GRCm39) missense probably damaging 1.00
R9715:Fut9 UTSW 4 25,620,679 (GRCm39) missense probably benign 0.00
X0057:Fut9 UTSW 4 25,799,686 (GRCm39) start gained probably benign
Predicted Primers PCR Primer
(F):5'- CAAAATATACATGGTCCTCAAGGG -3'
(R):5'- CTGGGTCCATCTAGGGAAAACTATG -3'

Sequencing Primer
(F):5'- CTCAAGGGAGGGCAGGAAAATTAAAC -3'
(R):5'- CAGCTGATTCATTCATTCATGTGG -3'
Posted On 2018-04-02