Incidental Mutation 'R6315:Zfyve9'
ID510581
Institutional Source Beutler Lab
Gene Symbol Zfyve9
Ensembl Gene ENSMUSG00000034557
Gene Namezinc finger, FYVE domain containing 9
SynonymsMadhip
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.529) question?
Stock #R6315 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location108637466-108780798 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 108674488 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 416 (T416S)
Ref Sequence ENSEMBL: ENSMUSP00000039852 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042185] [ENSMUST00000106657] [ENSMUST00000106658]
Predicted Effect probably damaging
Transcript: ENSMUST00000042185
AA Change: T416S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000039852
Gene: ENSMUSG00000034557
AA Change: T416S

DomainStartEndE-ValueType
Blast:FYVE 7 40 4e-7 BLAST
Pfam:SARA 52 92 1e-25 PFAM
Pfam:DUF3480 328 681 1.4e-189 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000106657
AA Change: T1107S

PolyPhen 2 Score 0.853 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000102268
Gene: ENSMUSG00000034557
AA Change: T1107S

DomainStartEndE-ValueType
low complexity region 230 243 N/A INTRINSIC
low complexity region 471 487 N/A INTRINSIC
low complexity region 578 587 N/A INTRINSIC
Blast:FYVE 590 618 7e-6 BLAST
FYVE 663 731 2.38e-26 SMART
Pfam:SARA 745 783 1.3e-22 PFAM
Pfam:DUF3480 1020 1372 1e-178 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000106658
AA Change: T1048S

PolyPhen 2 Score 0.707 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000102269
Gene: ENSMUSG00000034557
AA Change: T1048S

DomainStartEndE-ValueType
low complexity region 230 243 N/A INTRINSIC
low complexity region 471 487 N/A INTRINSIC
low complexity region 578 587 N/A INTRINSIC
Blast:FYVE 590 618 8e-6 BLAST
FYVE 663 731 2.38e-26 SMART
Pfam:DUF3480 960 1313 5.5e-189 PFAM
Meta Mutation Damage Score 0.0605 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 97% (64/66)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a double zinc finger motif-containing protein that participates in the transforming growth factor-beta (TGFB) signalling pathway. The encoded protein interacts directly with SMAD2 and SMAD3, and recruits SMAD2 to the TGFB receptor. There are multiple pseudogenes for this gene on chromosomes 2, 15, and X. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2013]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca15 T C 7: 120,346,092 Y464H probably damaging Het
Ahnak T C 19: 9,006,626 M1758T probably damaging Het
Ak9 A T 10: 41,406,841 D1201V possibly damaging Het
Amdhd2 A C 17: 24,158,356 H203Q probably benign Het
Ano3 A G 2: 110,697,039 M608T probably damaging Het
Arhgef4 G A 1: 34,723,477 A605T unknown Het
Atp1a2 C G 1: 172,289,336 R238P probably damaging Het
Atp8b1 C A 18: 64,531,479 R1206L probably damaging Het
B4galt5 A T 2: 167,305,809 N215K probably damaging Het
Bpifa1 A G 2: 154,146,076 K180E possibly damaging Het
Cadm1 C T 9: 47,810,119 T269M probably damaging Het
Cadm3 T C 1: 173,344,352 D252G probably benign Het
Ccdc18 A G 5: 108,161,582 R348G probably benign Het
Cers4 G A 8: 4,516,980 C94Y probably benign Het
Cfap58 G A 19: 47,941,277 R59H probably benign Het
Col19a1 C T 1: 24,526,452 G266D unknown Het
Col6a5 G T 9: 105,881,970 F2012L probably damaging Het
Dnah6 T C 6: 73,191,605 Q445R probably benign Het
Dsg3 A G 18: 20,524,586 S238G probably benign Het
E130308A19Rik G A 4: 59,691,132 S322N probably benign Het
Eif5b A G 1: 38,018,033 D57G unknown Het
Fbn2 T C 18: 58,054,953 probably null Het
Fbxo38 A T 18: 62,536,147 C77* probably null Het
Fgb T A 3: 83,045,055 Q169L probably benign Het
Fut9 A T 4: 25,619,774 Y347N probably damaging Het
Gabrg2 T C 11: 41,971,861 K132R probably damaging Het
Gpn3 C T 5: 122,372,575 probably benign Het
Helz2 A G 2: 181,233,202 L1833P probably damaging Het
Hk3 C T 13: 55,011,157 D484N probably benign Het
Icam4 T C 9: 21,029,952 V129A probably damaging Het
Impdh2 T C 9: 108,563,439 S280P possibly damaging Het
Impg1 C A 9: 80,394,074 G267V probably benign Het
Iqgap1 C T 7: 80,799,890 V39M possibly damaging Het
Lyst A G 13: 13,643,504 N1253S probably benign Het
Mgat4b T A 11: 50,231,764 V195E probably damaging Het
Mrgprb8 C T 7: 48,389,235 T218I probably damaging Het
Myrfl T G 10: 116,822,819 E411A possibly damaging Het
Myt1l T C 12: 29,827,798 S483P unknown Het
Neil2 A G 14: 63,183,471 V80A possibly damaging Het
Nfe2l2 G T 2: 75,676,819 D312E probably damaging Het
Nin A T 12: 70,045,615 L640Q probably damaging Het
Nup205 T A 6: 35,236,869 I1732N probably damaging Het
Nupl2 T C 5: 24,167,504 S97P probably damaging Het
Olfr1468-ps1 T C 19: 13,375,405 C148R unknown Het
Olfr180 A C 16: 58,916,246 Y132D probably damaging Het
Plcb1 A T 2: 135,346,341 T785S probably benign Het
Plch1 C T 3: 63,781,390 W131* probably null Het
Ppp1r1b A G 11: 98,355,390 E66G probably damaging Het
Ros1 A T 10: 52,118,210 W1325R probably benign Het
Sec14l5 A C 16: 5,180,277 E500A possibly damaging Het
Sirpb1c A G 3: 15,832,306 V302A possibly damaging Het
Spata19 T C 9: 27,400,837 Y107H possibly damaging Het
Sv2a G A 3: 96,188,186 M298I probably benign Het
Tdrd6 A T 17: 43,626,338 M1273K probably benign Het
Tectb A G 19: 55,191,472 H250R possibly damaging Het
Trip11 T G 12: 101,885,578 E742D possibly damaging Het
Tslp A G 18: 32,817,090 T71A probably benign Het
Usp20 C T 2: 31,017,758 R711C possibly damaging Het
Vmn1r181 G A 7: 23,984,758 R216Q probably benign Het
Vmn2r8 A T 5: 108,801,891 F363L probably benign Het
Vsnl1 T A 12: 11,332,155 N75I probably damaging Het
Wdr55 A T 18: 36,762,069 D96V probably damaging Het
Wls T A 3: 159,934,371 probably null Het
Zc3h13 A G 14: 75,308,915 D152G probably damaging Het
Zc3h18 A G 8: 122,383,865 E151G probably benign Het
Zfat A G 15: 68,084,462 S1174P probably damaging Het
Other mutations in Zfyve9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00162:Zfyve9 APN 4 108642107 missense possibly damaging 0.85
IGL01161:Zfyve9 APN 4 108681064 missense probably damaging 1.00
IGL01404:Zfyve9 APN 4 108682151 missense probably damaging 1.00
IGL01451:Zfyve9 APN 4 108682260 missense probably damaging 0.98
IGL01655:Zfyve9 APN 4 108642092 missense probably damaging 1.00
IGL02567:Zfyve9 APN 4 108674523 missense probably damaging 1.00
IGL02593:Zfyve9 APN 4 108682223 missense possibly damaging 0.73
IGL03169:Zfyve9 APN 4 108695825 missense probably damaging 1.00
IGL03206:Zfyve9 APN 4 108689209 missense possibly damaging 0.88
IGL03288:Zfyve9 APN 4 108723799 splice site probably benign
R0008:Zfyve9 UTSW 4 108718705 missense possibly damaging 0.92
R0008:Zfyve9 UTSW 4 108718705 missense possibly damaging 0.92
R0104:Zfyve9 UTSW 4 108718163 missense probably damaging 1.00
R0104:Zfyve9 UTSW 4 108718163 missense probably damaging 1.00
R0362:Zfyve9 UTSW 4 108680969 missense probably damaging 0.96
R0502:Zfyve9 UTSW 4 108719764 nonsense probably null
R0503:Zfyve9 UTSW 4 108719764 nonsense probably null
R0557:Zfyve9 UTSW 4 108674511 missense probably damaging 0.98
R0835:Zfyve9 UTSW 4 108718669 missense probably damaging 0.99
R1215:Zfyve9 UTSW 4 108650229 missense probably benign 0.32
R1245:Zfyve9 UTSW 4 108693311 intron probably benign
R1527:Zfyve9 UTSW 4 108695767 critical splice donor site probably null
R1638:Zfyve9 UTSW 4 108684907 critical splice donor site probably null
R1653:Zfyve9 UTSW 4 108660577 nonsense probably null
R1728:Zfyve9 UTSW 4 108718501 missense possibly damaging 0.80
R1729:Zfyve9 UTSW 4 108718501 missense possibly damaging 0.80
R1861:Zfyve9 UTSW 4 108682295 splice site probably benign
R1983:Zfyve9 UTSW 4 108689189 missense possibly damaging 0.94
R2050:Zfyve9 UTSW 4 108718603 missense probably benign 0.05
R2050:Zfyve9 UTSW 4 108719303 missense possibly damaging 0.94
R2246:Zfyve9 UTSW 4 108689264 missense possibly damaging 0.70
R2338:Zfyve9 UTSW 4 108660614 missense probably damaging 1.00
R2697:Zfyve9 UTSW 4 108695819 missense probably damaging 0.99
R3522:Zfyve9 UTSW 4 108719743 missense probably benign 0.45
R4030:Zfyve9 UTSW 4 108719701 missense possibly damaging 0.61
R4247:Zfyve9 UTSW 4 108719192 missense probably benign 0.28
R4273:Zfyve9 UTSW 4 108680976 missense probably damaging 1.00
R4720:Zfyve9 UTSW 4 108644368 missense possibly damaging 0.94
R4835:Zfyve9 UTSW 4 108717998 missense possibly damaging 0.70
R4871:Zfyve9 UTSW 4 108680986 missense probably damaging 1.00
R4881:Zfyve9 UTSW 4 108727491 utr 5 prime probably null
R4974:Zfyve9 UTSW 4 108680900 critical splice donor site probably null
R5024:Zfyve9 UTSW 4 108691669 missense probably benign 0.18
R5481:Zfyve9 UTSW 4 108644349 missense probably damaging 1.00
R5660:Zfyve9 UTSW 4 108719168 missense probably benign
R5965:Zfyve9 UTSW 4 108691681 missense possibly damaging 0.53
R5996:Zfyve9 UTSW 4 108719360 missense probably benign 0.07
R6772:Zfyve9 UTSW 4 108639269 missense probably damaging 1.00
R6865:Zfyve9 UTSW 4 108644361 missense possibly damaging 0.71
R7112:Zfyve9 UTSW 4 108650322 missense probably benign 0.00
R7258:Zfyve9 UTSW 4 108656954 missense possibly damaging 0.94
R7266:Zfyve9 UTSW 4 108718547 missense possibly damaging 0.62
R7287:Zfyve9 UTSW 4 108718256 missense probably benign 0.00
R7356:Zfyve9 UTSW 4 108719015 missense probably benign 0.01
R7389:Zfyve9 UTSW 4 108693318 critical splice donor site probably null
R7729:Zfyve9 UTSW 4 108691776 missense probably benign 0.01
R7780:Zfyve9 UTSW 4 108719101 missense possibly damaging 0.81
R7801:Zfyve9 UTSW 4 108684995 missense possibly damaging 0.50
R8069:Zfyve9 UTSW 4 108685018 missense probably benign 0.32
Z1176:Zfyve9 UTSW 4 108642207 missense possibly damaging 0.85
Predicted Primers PCR Primer
(F):5'- TCCACCAGAAATTTTATAGCTATGC -3'
(R):5'- AGTAAGTTCATCCGGTAGTGTC -3'

Sequencing Primer
(F):5'- GTCCGAAATTTATCACTCTACTT -3'
(R):5'- ATCCGGTAGTGTCATCATTTCTG -3'
Posted On2018-04-02