Incidental Mutation 'R6315:Iqgap1'
ID510590
Institutional Source Beutler Lab
Gene Symbol Iqgap1
Ensembl Gene ENSMUSG00000030536
Gene NameIQ motif containing GTPase activating protein 1
SynonymsD7Ertd237e, D7Ertd257e
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6315 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location80711583-80825974 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 80799890 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 39 (V39M)
Ref Sequence ENSEMBL: ENSMUSP00000128278 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000167377] [ENSMUST00000205304] [ENSMUST00000205813]
Predicted Effect possibly damaging
Transcript: ENSMUST00000167377
AA Change: V39M

PolyPhen 2 Score 0.652 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000128278
Gene: ENSMUSG00000030536
AA Change: V39M

DomainStartEndE-ValueType
CH 46 155 2.02e-20 SMART
internal_repeat_1 203 278 3.71e-8 PROSPERO
low complexity region 324 335 N/A INTRINSIC
low complexity region 390 399 N/A INTRINSIC
coiled coil region 488 515 N/A INTRINSIC
internal_repeat_1 608 684 3.71e-8 PROSPERO
IQ 744 766 3.85e-3 SMART
IQ 774 796 1.12e-4 SMART
IQ 804 826 1.32e-1 SMART
IQ 834 856 1.15e1 SMART
coiled coil region 886 914 N/A INTRINSIC
RasGAP 992 1345 7.46e-89 SMART
Pfam:RasGAP_C 1452 1580 4.5e-41 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000205304
AA Change: V53M

PolyPhen 2 Score 0.178 (Sensitivity: 0.92; Specificity: 0.87)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205540
Predicted Effect probably benign
Transcript: ENSMUST00000205813
AA Change: V61M

PolyPhen 2 Score 0.034 (Sensitivity: 0.95; Specificity: 0.82)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205824
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206149
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 97% (64/66)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the IQGAP family. The protein contains four IQ domains, one calponin homology domain, one Ras-GAP domain and one WW domain. It interacts with components of the cytoskeleton, with cell adhesion molecules, and with several signaling molecules to regulate cell morphology and motility. Expression of the protein is upregulated by gene amplification in two gastric cancer cell lines. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null allele exhibit a late-onset gastric hyperplasia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca15 T C 7: 120,346,092 Y464H probably damaging Het
Ahnak T C 19: 9,006,626 M1758T probably damaging Het
Ak9 A T 10: 41,406,841 D1201V possibly damaging Het
Amdhd2 A C 17: 24,158,356 H203Q probably benign Het
Ano3 A G 2: 110,697,039 M608T probably damaging Het
Arhgef4 G A 1: 34,723,477 A605T unknown Het
Atp1a2 C G 1: 172,289,336 R238P probably damaging Het
Atp8b1 C A 18: 64,531,479 R1206L probably damaging Het
B4galt5 A T 2: 167,305,809 N215K probably damaging Het
Bpifa1 A G 2: 154,146,076 K180E possibly damaging Het
Cadm1 C T 9: 47,810,119 T269M probably damaging Het
Cadm3 T C 1: 173,344,352 D252G probably benign Het
Ccdc18 A G 5: 108,161,582 R348G probably benign Het
Cers4 G A 8: 4,516,980 C94Y probably benign Het
Cfap58 G A 19: 47,941,277 R59H probably benign Het
Col19a1 C T 1: 24,526,452 G266D unknown Het
Col6a5 G T 9: 105,881,970 F2012L probably damaging Het
Dnah6 T C 6: 73,191,605 Q445R probably benign Het
Dsg3 A G 18: 20,524,586 S238G probably benign Het
E130308A19Rik G A 4: 59,691,132 S322N probably benign Het
Eif5b A G 1: 38,018,033 D57G unknown Het
Fbn2 T C 18: 58,054,953 probably null Het
Fbxo38 A T 18: 62,536,147 C77* probably null Het
Fgb T A 3: 83,045,055 Q169L probably benign Het
Fut9 A T 4: 25,619,774 Y347N probably damaging Het
Gabrg2 T C 11: 41,971,861 K132R probably damaging Het
Gpn3 C T 5: 122,372,575 probably benign Het
Helz2 A G 2: 181,233,202 L1833P probably damaging Het
Hk3 C T 13: 55,011,157 D484N probably benign Het
Icam4 T C 9: 21,029,952 V129A probably damaging Het
Impdh2 T C 9: 108,563,439 S280P possibly damaging Het
Impg1 C A 9: 80,394,074 G267V probably benign Het
Lyst A G 13: 13,643,504 N1253S probably benign Het
Mgat4b T A 11: 50,231,764 V195E probably damaging Het
Mrgprb8 C T 7: 48,389,235 T218I probably damaging Het
Myrfl T G 10: 116,822,819 E411A possibly damaging Het
Myt1l T C 12: 29,827,798 S483P unknown Het
Neil2 A G 14: 63,183,471 V80A possibly damaging Het
Nfe2l2 G T 2: 75,676,819 D312E probably damaging Het
Nin A T 12: 70,045,615 L640Q probably damaging Het
Nup205 T A 6: 35,236,869 I1732N probably damaging Het
Nupl2 T C 5: 24,167,504 S97P probably damaging Het
Olfr1468-ps1 T C 19: 13,375,405 C148R unknown Het
Olfr180 A C 16: 58,916,246 Y132D probably damaging Het
Plcb1 A T 2: 135,346,341 T785S probably benign Het
Plch1 C T 3: 63,781,390 W131* probably null Het
Ppp1r1b A G 11: 98,355,390 E66G probably damaging Het
Ros1 A T 10: 52,118,210 W1325R probably benign Het
Sec14l5 A C 16: 5,180,277 E500A possibly damaging Het
Sirpb1c A G 3: 15,832,306 V302A possibly damaging Het
Spata19 T C 9: 27,400,837 Y107H possibly damaging Het
Sv2a G A 3: 96,188,186 M298I probably benign Het
Tdrd6 A T 17: 43,626,338 M1273K probably benign Het
Tectb A G 19: 55,191,472 H250R possibly damaging Het
Trip11 T G 12: 101,885,578 E742D possibly damaging Het
Tslp A G 18: 32,817,090 T71A probably benign Het
Usp20 C T 2: 31,017,758 R711C possibly damaging Het
Vmn1r181 G A 7: 23,984,758 R216Q probably benign Het
Vmn2r8 A T 5: 108,801,891 F363L probably benign Het
Vsnl1 T A 12: 11,332,155 N75I probably damaging Het
Wdr55 A T 18: 36,762,069 D96V probably damaging Het
Wls T A 3: 159,934,371 probably null Het
Zc3h13 A G 14: 75,308,915 D152G probably damaging Het
Zc3h18 A G 8: 122,383,865 E151G probably benign Het
Zfat A G 15: 68,084,462 S1174P probably damaging Het
Zfyve9 T A 4: 108,674,488 T416S probably damaging Het
Other mutations in Iqgap1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00481:Iqgap1 APN 7 80759844 missense probably benign 0.00
IGL00984:Iqgap1 APN 7 80726798 missense probably damaging 1.00
IGL01570:Iqgap1 APN 7 80723061 missense possibly damaging 0.76
IGL01738:Iqgap1 APN 7 80723900 missense possibly damaging 0.80
IGL02141:Iqgap1 APN 7 80738121 missense probably damaging 1.00
IGL02336:Iqgap1 APN 7 80752293 missense probably benign 0.39
IGL02416:Iqgap1 APN 7 80726038 missense probably damaging 1.00
IGL02597:Iqgap1 APN 7 80723885 missense probably damaging 1.00
IGL02662:Iqgap1 APN 7 80743079 missense probably benign
IGL03157:Iqgap1 APN 7 80751888 missense probably benign 0.34
IGL03189:Iqgap1 APN 7 80713842 missense probably benign 0.12
IGL03216:Iqgap1 APN 7 80743088 missense probably benign 0.33
R0024:Iqgap1 UTSW 7 80751939 missense probably benign
R0126:Iqgap1 UTSW 7 80738322 missense probably benign 0.00
R0144:Iqgap1 UTSW 7 80751920 missense probably damaging 1.00
R0325:Iqgap1 UTSW 7 80751930 missense probably benign 0.01
R0376:Iqgap1 UTSW 7 80723879 missense probably benign 0.01
R0650:Iqgap1 UTSW 7 80736395 missense probably damaging 1.00
R0652:Iqgap1 UTSW 7 80736395 missense probably damaging 1.00
R0741:Iqgap1 UTSW 7 80720987 missense probably benign 0.03
R0751:Iqgap1 UTSW 7 80725573 unclassified probably benign
R1067:Iqgap1 UTSW 7 80723828 missense probably benign 0.01
R1389:Iqgap1 UTSW 7 80759756 critical splice donor site probably null
R1473:Iqgap1 UTSW 7 80734011 missense probably benign 0.00
R1613:Iqgap1 UTSW 7 80768457 missense probably damaging 1.00
R1842:Iqgap1 UTSW 7 80760883 missense probably damaging 1.00
R1909:Iqgap1 UTSW 7 80743828 missense probably benign
R2062:Iqgap1 UTSW 7 80723979 nonsense probably null
R2149:Iqgap1 UTSW 7 80762560 missense probably damaging 1.00
R2153:Iqgap1 UTSW 7 80751953 missense probably benign 0.00
R2153:Iqgap1 UTSW 7 80759903 missense possibly damaging 0.55
R3160:Iqgap1 UTSW 7 80752338 missense probably benign
R3162:Iqgap1 UTSW 7 80752338 missense probably benign
R3605:Iqgap1 UTSW 7 80723789 missense probably benign 0.02
R3709:Iqgap1 UTSW 7 80717087 missense possibly damaging 0.87
R3935:Iqgap1 UTSW 7 80743837 missense possibly damaging 0.54
R3979:Iqgap1 UTSW 7 80759934 missense probably damaging 0.98
R4545:Iqgap1 UTSW 7 80762567 critical splice acceptor site probably null
R4787:Iqgap1 UTSW 7 80735513 missense probably damaging 1.00
R4925:Iqgap1 UTSW 7 80765317 missense probably damaging 1.00
R4953:Iqgap1 UTSW 7 80723776 splice site probably null
R5037:Iqgap1 UTSW 7 80734100 missense probably damaging 1.00
R5158:Iqgap1 UTSW 7 80743068 missense probably benign 0.02
R5183:Iqgap1 UTSW 7 80723065 missense probably damaging 1.00
R5262:Iqgap1 UTSW 7 80726742 missense probably benign 0.00
R5271:Iqgap1 UTSW 7 80734148 missense probably damaging 1.00
R5289:Iqgap1 UTSW 7 80738724 missense possibly damaging 0.88
R5359:Iqgap1 UTSW 7 80766959 missense probably benign 0.00
R5423:Iqgap1 UTSW 7 80799862 missense probably damaging 1.00
R5843:Iqgap1 UTSW 7 80726080 missense probably benign 0.03
R5849:Iqgap1 UTSW 7 80803158 missense probably benign
R6164:Iqgap1 UTSW 7 80809106 missense unknown
R6335:Iqgap1 UTSW 7 80728024 missense probably damaging 1.00
R6488:Iqgap1 UTSW 7 80730326 missense probably benign 0.00
R6723:Iqgap1 UTSW 7 80723822 missense probably benign 0.01
R6800:Iqgap1 UTSW 7 80728981 missense possibly damaging 0.56
R6815:Iqgap1 UTSW 7 80766884 critical splice donor site probably null
R7240:Iqgap1 UTSW 7 80759839 missense probably benign 0.22
R7386:Iqgap1 UTSW 7 80726042 missense probably damaging 1.00
R7387:Iqgap1 UTSW 7 80720990 missense probably benign 0.03
R7410:Iqgap1 UTSW 7 80723030 nonsense probably null
R7429:Iqgap1 UTSW 7 80751440 missense probably benign 0.00
R7452:Iqgap1 UTSW 7 80760829 missense possibly damaging 0.80
R7615:Iqgap1 UTSW 7 80730100 missense probably damaging 1.00
R7615:Iqgap1 UTSW 7 80751346 missense probably benign
R7726:Iqgap1 UTSW 7 80757456 missense probably benign 0.37
R7783:Iqgap1 UTSW 7 80809059 missense probably benign 0.01
R7785:Iqgap1 UTSW 7 80738169 missense probably damaging 1.00
R7862:Iqgap1 UTSW 7 80743888 missense probably benign 0.04
R8270:Iqgap1 UTSW 7 80730127 missense probably damaging 1.00
RF004:Iqgap1 UTSW 7 80720875 missense probably benign
RF063:Iqgap1 UTSW 7 80723751 frame shift probably null
X0064:Iqgap1 UTSW 7 80720931 nonsense probably null
X0067:Iqgap1 UTSW 7 80766903 missense probably benign
Z1176:Iqgap1 UTSW 7 80768309 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CAGGCACAAGTGTTCGACAG -3'
(R):5'- AGCCTGCCTTTCTAGGTGAC -3'

Sequencing Primer
(F):5'- CAGTTAGGAACACTTGCTGC -3'
(R):5'- ACTAGCAGCAATTTGATGGTGG -3'
Posted On2018-04-02